Showing posts with label host specificity. Show all posts
Showing posts with label host specificity. Show all posts

Saturday, January 30, 2016

This Month in Blastocystis Research (JAN 2016)

Three publications have caught my attention over the past month.

The first one is by my Turkish colleagues Kurt, Dogruman-Al, and Tanyüksel. They just published the paper "Eradication of Blastocystis in humans: Really necessary for all?" This title implies that treatment of Blastocystis is recommendable in some cases. The authors appear to acknowledge the view that treatment should be given to symptomatic carriers when all other causes of gastrointestinal symptoms have been rule out, - the popular 'last-resort' approach.

What I think is really useful and admirable is that the authors leave so many questions open/unanswered, despite the fact that they have been "in business" for so many years, representing some of the most avid Blastocystis researchers. It becomes clear from reading the paper that even in 2016, we still do not know how to eradicate Blastocystis from the intestine in those cases where we'd really like to try and do so. Importantly, the authors give examples of data supporting the fact that treatment failure may be due to failure of the drug to reach the parasite as well as treatment resistance. They also highlight the possibility that eradication of Blastocystis by antibiotic/anti-protozoal agents may be due to microbiota perturbation rather than a direct action on Blastocystis. I also very much appreciate the fact that the authors are embracing the necessity of studying Blastocystis in a parasite-microbiota-host context in order to be able to draw useful conclusions on its role in human health and disease.

Das and colleagues just published data on Blastocystis and subtypes of Blastocystis in IBS patients and controls in New Delhi, India. Using multiple traditional and DNA-based methods, they found that in their study material, the prevalence of Blastocystis was higher among patients with IBS than among healthy controls. It is not exactly clear how the controls were picked and what type of study population they represented. What I found really useful is the fact that they not only carried out subtyping of Blastocystis, but also identified subtype alleles. The subtypes and alleles found in the study were very similar to those found recently by Pandey et al. (2015) in Maharashtra, India.  Interestingly, it appears that only two subtypes are found in humans in India, namely ST1 and ST3. However, only two studies from India are available on subtypes in humans, to my knowledge, and so we need much more data to draw conclusions.

The last paper that I'm going to address is one by Zanzani and colleagues. When I read the abstract I almost dislocated my lower jaw from stupefaction: Studying the gastrointestinal parasitic fauna of captive non-human primates (Macaca fascicularis), they found a variety of protozoa and helminths, which is not surprising at all. Neither is it surprising that most macaques were positive for Blastocystis. Now, what really made my jaw drop was the fact their data on the subtypes found in the macaques challenged the host specificity of Blastocystis identified so far: They reported finding ST1, ST2, ST3, ST5, and ST7. And so, I had a closer look at the methods used to obtain data on subtypes. I take the liberty of questioning the data, since the authors report using a set of primers for amplification of Blastocystis DNA targeting the SSU rRNA gene, while using the STS primers developed by Yoshikawa et al. as sequencing primers! I guess that it is possible that the description of the methods was flawed (should have been picked up by the reviewer though), in which case I hope that an erratum will be developed and published.

References:

Das R, Khalil S, Mirdha BR, Makharia GK, Dattagupta S, & Chaudhry R (2016). Molecular Characterization and Subtyping of Blastocystis Species in Irritable Bowel Syndrome Patients from North India. PloS One, 11 (1) PMID: 26784888  

Kurt Ö, Doğruman Al F, & Tanyüksel M (2016). Eradication of Blastocystis in humans: Really necessary for all? Parasitology International PMID: 26780545

Pandey PK, Verma P, Marathe N, Shetty S, Bavdekar A, Patole MS, Stensvold CR, & Shouche YS (2015). Prevalence and subtype analysis of Blastocystis in healthy Indian individuals. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases, 31, 296-9 PMID: 25701123  

Zanzani SA, Gazzonis AL, Epis S, & Manfredi MT (2016). Study of the gastrointestinal parasitic fauna of captive non-human primates (Macaca fascicularis). Parasitology Research, 115 (1), 307-12 PMID: 26374536  

Yoshikawa H, Wu Z, Kimata I, Iseki M, Ali IK, Hossain MB, Zaman V, Haque R, & Takahashi Y (2004). Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries. Parasitology Research, 92 (1), 22-9 PMID: 14598169

Monday, October 5, 2015

This Month in Blastocystis Research (SEP 2015)

The month of September saw the publication of the first data on Blastocystis subtypes going out from Qatar. Abu-Madi and colleagues--who have already been quite prolific in terms of surveying intestinal parasitic infections in Qatar--studied the positive rate of Blastocystis in 608 apparently healthy subjects arriving in Qatar for the first time, identifying a prevalence of 71% as identified by PCR. Strikingly, the positive rate by microscopy of the corresponding samples was only 7%. Three subtypes were idenfied, with ST3 being the most common subtype, followed in prevalence by ST1 and ST2. The study is important for at least two reasons: It confirms the drawback of basing Blastocystis epidemiological research on data generated using microscopy alone, and it confirms the virtual absence of ST4 outside of Europe.

Increased sensitivity of PCR relative to microscopy was also confirmed in a study carried out in Malaysia (I presume) by Ragavan and colleagues. This group surveyed the Blastocystis positivity rate among IBS and non-IBS patients analyzing colonic aspirates, including a total of 109 individuals. Given the data available on Blastocystis prevalence, I was quite surprised to learn that this group failed to detect Blastocystis in any of the samples by microscopy and culture. Using PCR (the subtype-specific [STS] primers were used as diagnostic primers), the group identified Blastocystis in 6 IBS patients and 4 non-IBS patients. Also these figures appear quite low. However, there is very little information available on the non-IBS patients, and since all study individuals were subject to colonscopy, this group of individuals might be suffering chronic and potentially severe intestinal disease, including for instance colorectal cancer, inflammatory bowel disease, etc., which would explain the low prevalence of Blastocystis observed among these individuals. Indeed, evidence is accumulating that the more "gut healthy" you are, the larger the probability of being Blastocystis-positive. I noticed that the colonic aspirates were spun down using 3,000 rpm prior to culture and microscopy; this process might have had an impact on cell viability and morphology; still, DNA should be detectable following this process. Meanwhile, we recently showed (Scanlan et al., 2015) that the sensitivity of the STS primers is relatively low, which is why the use of real-time PCR is recommendable for PCR-based screening. To see an example of how the STS primers perform relative to barcoding primers, go here (Suppl Table 2).
Moreover, care should be taken when reading this paper, since I'm fairly convinced that the subtype terminology used in the study is different from the consensus terminology (Stensvold et al., 2007). It says that the subtypes detected included ST2, ST3, ST4, and ST5; if this reflects the terminology that went along with the original description of the STS primers, these subtypes correspond to ST7, ST3, ST6, and ST2, which to me would be a more likely subtype distribution, taking this particular region into consideration, and given the fact that ST5 appears to be extremely rare in humans. 

It's always interesting to expand on the natural host spectrum of Blastocystis. The parasite has been found in a perplexing array of hosts, but some host specificity has been observed. When it comes to animals held by humans as livestock or pets, we know that pigs and cattle are commonly, if not consistently, colonised by Blastocystis with some quite specific subtypes. With regard to pets, dogs and cats have been found positive, but there seems to be increasing evidence that these animals are not natural hosts (see also Wang et al., 2013). Osman and colleagues, recently published a survey on Cryptosporidium and Blastocystis in dogs using sensitive molecular methods, demonstrating a prevalence of Blastocystis of only about 3%. Moreover, the subtypes 2 and 10 were found, and ST10 is found mostly in cattle, and never before in dogs, as far as I know, which could suggest accidental colonisation - and possibly not a very long-lasting one. Similarly, when humans are found to be colonised with subtypes rarely found in humans, such as ST6, ST7, and ST8, it would be interesting to know for how long these subtypes are capable of "staying put" in the human intestine.

References

Abu-Madi M, Aly M, Behnke JM, Clark CG, & Balkhy H (2015). The distribution of Blastocystis subtypes in isolates from Qatar. Parasites & Vectors, 8 PMID: 26384209

Osman M, Bories J, El Safadi D, Poirel MT, Gantois N, Benamrouz-Vanneste S, Delhaes L, Hugonnard M, Certad G, Zenner L, & Viscogliosi E (2015). Prevalence and genetic diversity of the intestinal parasites Blastocystis sp. and Cryptosporidium spp. in household dogs in France and evaluation of zoonotic transmission risk. Veterinary Parasitology PMID: 26395822   

Ragavan, N., Kumar, S., Chye, T., Mahadeva, S., & Shiaw-Hooi, H. (2015). Blastocystis sp. in Irritable Bowel Syndrome (IBS) - Detection in Stool Aspirates during Colonoscopy PLOS ONE, 10 (9) DOI: 10.1371/journal.pone.0121173  

Scanlan PD, Stensvold CR, & Cotter PD (2015). Development and Application of a Blastocystis Subtype-Specific PCR Assay Reveals that Mixed-Subtype Infections Are Common in a Healthy Human Population. Applied and Environmental Microbiology, 81 (12), 4071-6 PMID: 25841010   

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Wang W, Cuttell L, Bielefeldt-Ohmann H, Inpankaew T, Owen H, & Traub RJ (2013). Diversity of Blastocystis subtypes in dogs in different geographical settings. Parasites & vectors, 6 PMID: 23883734

Wednesday, December 11, 2013

Molecular Epidemiology: Developing a Language

Initiatives towards standardising diagnostic methods and convening on taxonomy and reference data is extremely important in a world where multiple research teams independently carry out research using molecular markers to identify and differentiate species and genotypes of infectious organisms; such activity is crucial to identify patterns of transmission, differences in virulence, and opportunities for control and intervention. Without such standards, efforts to survey and surveil such organisms would be more or less futile, and so they are the backbone of molecular epidemiology.

Having seen that a variety of morphologically similar but genetically diverse Blastocystis organisms found in humans could in fact colonise a range of different hosts, we realised back in 2006 that all these variants could not all be 'Blastocystis hominis', which was then the species name used for Blastocystis found in humans, and together with colleagues we took to revisiting Blastocystis terminology: We recognised that we did not know enough about host specificity and genetic diversity to be able to come up with relevant species names, and so we invented (or maybe not invented, but at least 'formalised') the subtype system, a sort of a barcode system, where genetically similar (typically 98-100%) organisms are assigned to the same subtype, hence ST1, ST2, ST3, etc., which we today now know so well.

Slapeta now suggests a barcoding system for Cryptosporidium. This single-celled parasite takes a major toll on the health of infants and toddlers in developing countries (in some places surpassed only by norovirus), and may also cause debilitating disease in immunocompromised. The nomenclature for Cryptosporidium is very complicated for those of us who are not experts; for instance, I only recently realised that C. parvum may now only refer to the Mouse I genotype and not the 'common' or 'traditional' C. parvum (which now appears to be C. pestis), which is common in both humans and cattle. However, there is a debate going on as to which taxonomy should be followed, and whether this novel leap in 'Cryptosporidium taxonomy revision' can be endorsed by Slapeta's fellow Crypto experts, remains to be seen. Contentiousness aside, barcoding Cryptosporidium does seem relevant due to the fact that the host specificity of Cryptosporidium is relatively loose; for instance humans and cattle are known to share at least 9 species of Cryptosporidium... 

In his paper, Jan Slapeta lists all the known species of Cryptosporidium (in the 'revised' terminology), and even includes GenBank reference strains for common molecular markers such as actin, HSP70 and COWP1 used for genotyping. Interestingly, he does not include the GP60 marker, a molecular marker for which the terminology is also discordant.

Slapeta moreover includes a file with reference SSU rDNA sequences that enable a standardisation of genetic analyses. This year, we did in fact a similar thing for Blastocystis: Along with our 2013 Protist paper surveying Blastocystis subtypes in animals (including the identification of a couple of new subtypes!), we uploaded a reference alignment consisting of some complete SSU rRNA gene sequences present in GenBank; one or more for each of the now known 17 subtypes; more will be added as more subtypes are discovered. The file can be downloaded when accessing the online version of the paper, and we hope that everyone interested in analysing sequences that represent potentially novel subtypes will use this reference alignment (which has been edited to eliminate regions of ambiguous base alignment); it should be quite helpful. Again, I also bring your attention to the pubmlst Blastocystis database, where fast files obtained by Blastocystis barcoding can be queried in batches for quick analysis of large amounts of sequence data. There's a Youtube video here on Blastocystis barcoding and how to use the pubmlst database.

Consensus on methods, terminology and diagnostic algorithms is essential to developing a common language and understanding of how infectious organisms impact our lives; without it,  confusion wreaks havoc with our efforts.

Literature:

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574

Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, Wu Y, Sow SO, Sur D, Breiman RF, Faruque AS, Zaidi AK, Saha D, Alonso PL, Tamboura B, Sanogo D, Onwuchekwa U, Manna B, Ramamurthy T, Kanungo S, Ochieng JB, Omore R, Oundo JO, Hossain A, Das SK, Ahmed S, Qureshi S, Quadri F, Adegbola RA, Antonio M, Hossain MJ, Akinsola A, Mandomando I, Nhampossa T, Acácio S, Biswas K, O'Reilly CE, Mintz ED, Berkeley LY, Muhsen K, Sommerfelt H, Robins-Browne RM, & Levine MM (2013). Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet, 382 (9888), 209-22 PMID: 23680352

Šlapeta J (2013). Cryptosporidiosis and Cryptosporidium species in animals and humans: a thirty colour rainbow? International Journal for Parasitology, 43 (12-13), 957-70 PMID: 23973380  

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Striepen B (2013). Parasitic infections: Time to tackle cryptosporidiosis. Nature, 503 (7475), 189-91 PMID: 24236315

Xiao L, Ryan UM, Fayer R, Bowman DD, & Zhang L (2012). Cryptosporidium tyzzeri and Cryptosporidium pestis: which name is valid? Experimental Parasitology, 130 (3), 308-9 PMID: 22230707 

Friday, June 21, 2013

This Month In Blastocystis Research (JUN 2013)

Another paper in the string of publications coming out from the PhD study by Dr Alfellani (London School of Hygiene and Tropical Medicine) has just appeared in PubMed.

Dr Alfellani and his colleagues have done a great job in analysing a multitude of samples from humans, non-human primates and animals; I have previously blogged about their observations from studies of human and non-human primates. Moreover, they have surveyed available data in order to better discuss their own findings, and the work has contributed significantly to what today is known about the host specificity, genetic diversity, phylogeography and general molecular epidemiology of Blastocystis.

Alfellani's most recent paper is published in the journal Protist, and it deals with the 'Genetic Diversity of Blastocystis in Livestock and Zoo Animals'.

It is quite a large paper which includes a lot of new information and a comprehensive (and hopefully exhaustive) table summarising Blastocystis subtype data in all relevant hosts (humans, non-human primates, other mammals and birds).

I will highlight a couple of things from the paper:

1. Apart from reporting on virtually complete SSU rDNA sequences from a couple of subtypes for which entire SSU rDNA sequences have yet not been available, we also report on three novel subtypes. Until recently, we only knew about 14 subtypes (ST1-ST14), of which ST1-ST9 can be found in humans. Now, three additional subtypes have been identified; ST15 in artiodactyls (camel and sheep) and non-human primates (chimpanzee and gibbon), ST16 in kangaroos, and ST17 in gundis.

The Gundi (Ctenodactylus gundi) is a rodent living mainly in the deserts of Northern Africa. (Source)

2. Novel data arising from analysis of faecal samples from humans and animals in Sebha, Libya, strongly indicate that humans and animals in this area are infected by different subtypes: Humans appear to carry ST1, ST2, and ST3, while synanthropic animals (artiodactyls in this case) mostly have ST5 and ST10 infections, suggesting that livestock is not a major contributor to human Blastocystis infection.

To this end, there is growing evidence of quite a substantial degree of host specificity of Blastocystis.  Even when subtypes overlap between humans and animals, we have accumulating evidence that the strains found in humans and animals are different. This means that the hypothesis that animals constitute an important reservoir of human Blastocystis infections currently has very limited support. It is my clear impression that when a strain of ST6 or ST8 is detected in humans, this strain has most probably been transmitted from an animal source. But we very rarely see these subtypes in humans, at least in Europeans.

It will be extremely interesting to see how the universe of Blastocystis subtypes unfolds... by genetically characterising strains in humans and non-human hosts, we are building up a clearer picture of transmission patterns and evolutionary biology, including our adaptation to Blastocystis, and the parasite's adaptation to us and other hosts.

It is noteworthy that we are starting to see different subtypes in rodents. We have previously thought that generally, rodents were infected by ST4. But now we know that many rodents are not infected, and we also know that rodents may harbour subtypes other than ST4.

So,17 subtypes of Blastocystis are now known. We have probably only seen the top of the iceberg, since many host species have not yet been sampled from, and it is likely that we will see quite a few STs being identified in the nearest future. To this end it is necessary to have a consensus regarding the identification of novel subtypes. Along with the Protist paper we have uploaded a supplementary file (Appendix A, TXT format) with aligned reference sequences that can be used for phylogenetic analysis,  hoping that it will be useful to our colleagues. In a future blog post I will try to address the issues of identifying new subtypes more specifically.

ST15 is one of the more interesting subtypes since it appears to have quite a low host specificity - infecting both non-human primates and artiodactyls. Yet, we have come across it only now. ST15 and ST17 are remarkable in the way that they appear to be closer related to herptile and arthropod lineages, respectively, than to lineages from mammals.

Please note that virtually complete sequences of ST10, ST13, ST14, ST15, and ST17 analysed in the study have been released in GenBank just now.

Further reading:

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic Diversity of Blastocystis in Livestock and Zoo Animals. Protist, 164 (4), 497-509 PMID: 23770574

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980

Alfellani MA, Jacob AS, Perea NO, Krecek RC, Taner-Mulla D, Verweij JJ, Levecke B, Tannich E, Clark CG, & Stensvold CR (2013). Diversity and distribution of Blastocystis sp. subtypes in non-human primates. Parasitology, 140 (8), 966-71 PMID: 23561720

Friday, June 29, 2012

On Blastocystis and Animal Models

I was recently encouraged by one of my readers to do a blog post on Blastocystis and animal experimental models. This is not exactly my core competence, which probably boils down to the fact that animal models have only been scarcely used in Blastocystis research for reasons that I will try to account for below.

Animal models (mice, rats, guinea pigs) have often been used to study interactions between hosts and microbes as well as the effect of chemotherapeutic interventions. Therefore, one might assume that animal models are an obvious way of potentially establishing a link between Blastocystis and pathology. But currently, the rationale for carrying out some types of Blastocystis experiments on, say, mice or rats is limited. Why? Well, first and foremost because of at least three major issues.

1) Lack of correlation between in vitro and in vivo evidence. Experimental infections of laboratory mice (Elwakil and Hewedi, 2010) resulted in tissue invasion - something never reported in humans. Another study showed increased oxidative stress in Blastocystis infected rats (Chandramathi et al., 2010), again something not linked to human colonisation. Studies that provided evidence for induction of cytokines, contact mediated apoptosis, and barrier disruption all used axenic Blastocystis and in vitro mammalian cell cultures with no evidence that these effect occur in vivo.

2) Host specificity. Blastocystis exhibits extreme genetic diversity and multiple, genetically very different variants (species, subtypes) exist. These subtypes exhibit moderate host specificity. This means that some subtypes are common in one type of host, whereas other subtypes are common in other types of hosts. For instance, ST5 is very common in pigs, but we rarely see it in humans. ST4 is common in rodents, and in some human populations (mainly Europe it seems), but otherwise extremely uncommon. And so on. This means that some subtypes may be difficult to establish in experimental animals. It also means that any pathology detected in the animal, may not be “reproducible” in another host, - maybe due to the fact that this host has adapted to this particular subtype or even strain. Blastocystis is common in a huge variety of animals, and different animals may have adapted do different subtypes. It is not unlikely that this is due to co-evolution, and therefore it may not turn out to be a big surprise if Blastocystis per se is not usually directly associated with disease. It may still be so, however, that for humans, some subtypes or strains may be associated with disease, preliminary data point in this direction.

3) Study design. Another issue is the use of appropriate controls – for example, experimental infection of animals with Blastocystis from cultures growing with bacteria need to have the appropriate controls - namely infection with the accompanying bacterial flora alone – before it can be concluded that Blastocystis is responsible for any effects seen. It is extremely difficult to axenise (i.e. make sterile) Blastocystis strains, so they will always be accompanied by some bacterial species. Hence, any effect noticed after challenge with a Blastocystis strain will be difficult to interpret, - is it due to Blastocystis or to accompanying bacterial strains? (If you want to see what Blastocystis look like in culture, go to my previous blog post here.)

So, results from scientific studies using animal experimental models should be interpreted cautiously. In vitro experimental models using enterocyte mono-layers for instance may constitute a more attractive alternative, but the problems of using xenic (i.e. unsterile) strains are evident also here. A great challenge ahead is the development of a standardised method for axenising (sterilising) strains… so far, such a method does not exist.

Our French colleagues recently published the genome of Blastocystis sp. ST7. Functional genomic analysis is key to understanding the extent to which Blastocystis is capable of exerting any direct pathological effect, and will assist us in studying the potential pathogenicity of Blastocystis in the absence of a suitable animal model. Indirect pathological effects may be more difficult to identify and probably require studies of the interaction between the host, the parasite and the rest of the gut microbiota (bacteria). Given our recent technological advances, I believe that a pathway to knowledge lies in the study of Blastocystis in an ecological context. I think that we should get an understanding of: 1) Who are colonized with Blastocystis, 2) From where do we get it, 3) For how long do we have the parasite, and do we establish symptoms in the very beginning, only to adapt to the presence of the parasite later on, 4) does Blastocystis require a particular flora to establish (and are there differences between subtypes (in humans and animals)), 5) could Blastocystis be seen as a proxy for a given gut microbiota (biomarker), and/or does Blastocystis select for a given microbiota phenotype (metatranscriptomic analysis of the intestinal flora accompanying Blastocystis might be useful to study how the bacteria “behave” (i.e. gene expression) in the presence/absence of Blastocystis), 6) are any Blastocystis-induced symptoms related to parasite abundance, etc.; this can be explored in rough detail by using real-time PCR, of which two have been published.

So, while animal models may not be immediately suitable in our quest to study Blastocystis pathogenicity, our “omics” methodologies and data analyses may sooner than we know help us answer many of the questions that we have been pondering for decades.

Having said that, I think that for instance a pig experimental model might be useful in terms of studying the effect of chemotherapeutic intervention. Obvious studies include those aiming to identify drugs capable of eradicating Blastocystis, but it could also be interesting to study the structure and function (gene expression profiling) of the accompanying microbiota before and after intervention.
Since pig feed often contains a range of antibiotics, it could be interesting to test whether pigs on diets +/- antibiotics differ in terms of Blastocystis colonisation... a recent PNAS paper demonstrates a shift in the structure and function of the microbiome in medicated pigs compared to pigs fed a diet void of antibiotics.

Further reading:

Chandramathi S, Suresh KG, Mahmood AA, & Kuppusamy UR (2010). Urinary hyaluronidase activity in rats infected with Blastocystis hominis--evidence for invasion? Parasitology research, 106 (6), 1459-63 PMID: 20358228

Elwakil HS, & Hewedi IH (2010). Pathogenic potential of Blastocystis hominis in laboratory mice. Parasitology research, 107 (3), 685-9 PMID: 20499092

Hussein EM, Hussein AM, Eida MM, & Atwa MM (2008). Pathophysiological variability of different genotypes of human Blastocystis hominis Egyptian isolates in experimentally infected rats. Parasitology research, 102 (5), 853-60 PMID: 18193282 

Iguchi A, Ebisu A, Nagata S, Saitou Y, Yoshikawa H, Iwatani S, & Kimata I (2007). Infectivity of different genotypes of human Blastocystis hominis isolates in chickens and rats. Parasitology international, 56 (2), 107-12 PMID: 17251054

Looft T, Johnson TA, Allen HK, Bayles DO, Alt DP, Stedtfeld RD, Sul WJ, Stedtfeld TM, Chai B, Cole JR, Hashsham SA, Tiedje JM, & Stanton TB (2012). In-feed antibiotic effects on the swine intestinal microbiome. Proceedings of the National Academy of Sciences of the United States of America, 109 (5), 1691-6 PMID: 22307632

Scanlan PD (2012). Blastocystis: past pitfalls and future perspectives. Trends in parasitology PMID: 22738855

Stensvold CR, Alfellani MA, Nørskov-Lauritsen S, Prip K, Victory EL, Maddox C, Nielsen HV, & Clark CG (2009). Subtype distribution of Blastocystis isolates from synanthropic and zoo animals and identification of a new subtype. International journal for parasitology, 39 (4), 473-9 PMID: 18755193

Stensvold CR (2012). Thinking Blastocystis out of the box. Trends in parasitology PMID: 22704911

Yan Y, Su S, Ye J, Lai X, Lai R, Liao H, Chen G, Zhang R, Hou Z, & Luo X (2007). Blastocystis sp. subtype 5: a possibly zoonotic genotype. Parasitology research, 101 (6), 1527-32 PMID: 17665214

Monday, May 7, 2012

Blastocystis: To Treat or Not to Treat...

This year, Coyle et al. published a Clinical Practice paper in Clinical Infectious Diseases, a journal with a 5-year impact factor of almost 8. It is still difficult to get papers on Blastocystis published in clinical, peer-reviewed journals of major impact, probably due to the fact that evidence of Blastocystis' pathogenicity is so far only indicative, so it is great to see that the authors have managed to get their manuscript past those iron doors!

A few issues have come to my attention. When reading the abstract the reader will get the impression that subtypes are synonymous with genotypes, which is not the case. In the case of Blastocystis, a subtype is equivalent to a species; one of the reasons why we haven't allocated species names to Blastocystis from humans, other mammals and birds yet, is that we do not have sufficient data on genetic diversity and host specificity to come up with relevant names.

It says in the first page (pdf) that Blastocystis subtype (ST) 3 is found only in humans, which is not true. This subtype is common in non-human primates and can be seen in other, larger animals, including dogs, and also birds, if I remember correctly. However, so far, we only have multilocus sequence typing data from human and non-human primates, and these data indicate that ST3 found in non-human primates is often different from ST3 found in humans.

The authors recommend that asymptomatic individuals with few cysts should not be treated. Then what about asymptomatic individuals with many cysts? Also, with the diagnostic short-comings of microscopy of faecal concentrates, the suggested cut-off at 5 organisms per visual field appears arbitrary and, in best case, fortuitous.

In the abstract, the authors state that metronidazole is the drug of choice, although they appear to be quite aware that this drug has limited effect in terms of eradicating Blastocystis. So, why is metronidazole the drug of choice? Blastocystis is a parasite lodged primarily in the large intestine, and therefore we must anticipate that metronidazole often fails to reach the the parasite in sufficient concentrations due to absorption proximally in the gut. Luminal agents, such as paromomycin, are probably more likely to work, maybe in combination with metronidazole, although we have had a case, where even this combination was not effective.


When reviewing studies of treatment, it is important to acknowledge that insensitive methods have been used to evaluate drug efficacy. Culture combined with PCR is in my opinion the best method available in this respect. I prefer adding culture to the test, since culture detects viable Blastocystis (as opposed to PCR which will detect both viable and non-viable cells). Future randomised controlled treatment studies should therefore use culture and PCR to identify carriers both pre- and post-treatment. Whether Blastocystis-positive stool post-treatment is due to recrudescence, resistance or reinfection is not easily evaluated, but some useful information can be achieved by multi-locus sequence typing of isolates pre- and post-treatment.

Literature cited:

Coyle CM, Varughese J, Weiss LM, & Tanowitz HB (2012). Blastocystis: to treat or not to treat... Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 54 (1), 105-10 PMID: 22075794  

Stensvold CR, Alfellani M, & Clark CG (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 12 (2), 263-73 PMID: 22116021  

Stensvold CR, Smith HV, Nagel R, Olsen KE, & Traub RJ (2010). Eradication of Blastocystis carriage with antimicrobials: reality or delusion? Journal of clinical gastroenterology, 44 (2), 85-90 PMID: 19834337

Wednesday, April 25, 2012

Blastocystis Facts Sheet

I've tried to summarise a few facts here:
  • Blastocystis is a single-celled, microbial parasitic protist colonising mainly the large intestine of man and other mammals, birds, reptiles, and other animals, even insects.
  • The parasite is extremely common in humans, and possibly the most common microbial non-fungal eukaryote in the human intestine. More than one billion people may be colonised.
  • Blastocystis comprises many ribosomal lineages, most or all of which are comparable to separate species; they are currently known as subtypes (ST).
  • Humans are common hosts of ST1, ST2, ST3 and ST4, whereas other subtypes such as ST6, ST7 and ST8 are seen occasionally. ST5 and ST9 are very rare in humans. 
  • Almost all subtypes found in humans are also found in animals; however, zoonotic transmission is probably uncommon, at least for the most common subtypes (ST1—ST4).
  • Most carriers do probably not experience more intestinal symptoms than the average individual.
  • We do not know when to seek to eradicate Blastocystis and there are no valid treatment guidelines. The effect of metronidazole may be very limited.
  •  ST3 is probably the most common subtype in humans.
  • ST4 may be more much more common in Europe than outside Europe. 
  • ST4 has been seen frequently in patients with different types of diarrhoea or other intestinal problems, but appears uncommon in healthy individuals.
  • Blastocystis is best detected by (real-time) PCR and culture; conventional parasitological techniques have generally poor sensitivity.
·         Ongoing epidemiological studies seek to analyse subtype distributions in various cohorts, e.g. IBS patients and the background population. We also continuously explore the genetic variation and host specificity of Blastocystis. Genome studies seek to unravel virulence genes that may be involved in pathogenesis, but only the genome for ST7 has been sequenced so far.

Friday, April 6, 2012

Why "Blastocystis sp." and not "Blastocystis hominis"?

Blastocystis identified in humans used to be referred to as "Blastocystis hominis". However, after the advanced use of nucleic acid-based tools in the 90s and 00s it became clear that

1) morphologically identical Blastocystis can be genetically extremely diverse
2) Blastocystis in humans comprises at least 9 species (or, perhaps more correctly, ribosomal lineages), 8 of which can be found in other animals as well.

This means that host origin is not a reliable indicator of organism identity.

Blastocystis appears to exhibit only moderate host specificity - at least at subtype level - , and until a more substantial sampling from various hosts has been carried out, we will have to go with "Blastocystis sp." followed by an appropriate subtype (ST) number (according to species/ribosomal lineage), e.g. "Blastocystis sp. ST3", which is one of the 4 subtypes commonly found in humans.

In order to make subtype analysis very easy, we have created a site (together with Keith Jolley, Oxford University), where a bulk of sequences can be assigned to subtype in few seconds. Single sequence entries are also possible.

To sum up: Blastocystis hominis is a misleading and currently an invalid taxon.

(Read more about this in our Blastocystis consensus paper from 2007 in Trends in Parasitology)

Tuesday, April 3, 2012

Blastocystis Subtyping - Easy Peasy!

If you are a student or young scientist interested in intestinal parasites and/or infectious disease/molecular epidemiology, why not take to Blastocystis subtyping? It's easy, quick, cheap, and you are guaranteed results. You don't have to sit around and wait for positive samples.
And, best of all: Your data will make a difference!

Once you have your "barcode" sequence(s), you just paste them into the box as described below in the post "Is Blastocystis Zoonotic?", and you will get subtype and allele data right there, without having to consult other resources. However, we recommend that you familiarise yourself with essential papers such as 

Noel et al. (2005)
Scicluna et al. (2006)
Stensvold et al. (2007)

So, how do you get your sequences? Well, you can use DNAs extracted directly from faecal samples (faecal DNAs) or from cultures (I will soon post a note on Blastocystis culture). Multiple PCRs have been described for genetic characterisation of Blastocystis, and most of them target the small subunit (SSU) rRNA gene (18S).

For a variety of reasons (which we are currently listing in an upcoming review - watch out for it!), we recommend using the barcoding approach launched by Scicluna et al. (2006). The RD5 primer combined with BhRDr amplifies a region of approximately ~600 bp, which is usually sufficient to distinguish between subtypes.

Substantial sampling has been done in Europe, while data from Sub-Saharan Africa and the Americas are scarce. Sampling from animals is also highly warranted, especially from rodents, since this group appears to constitute a potential reservoir for human ST4.

In your search for subtypes, it is not unlikely that you will stumble upon what appears to be a new subtype, especially if you are analysing samples from animals. In that case, we recommened that you sequence the entire SSU rRNA gene. Using faecal DNA, this can be challenging (but possible!), so if you have the isolate in culture, then DNA should be extracted from the isolate and used instead to save money and effort. We are about to come up with some thoughts on how to determine whether a sequence represents a new subtype. Stay tuned!

Sunday, April 1, 2012

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:
AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA
Exactly! Subtype 1, allele 4!

Saturday, March 31, 2012

Some updates on Blastocystis

Blastocystis is a micro-eukaryote, a so-called protist, parasitising the intestine of humans and a variety of animals.

We estimate that at least 1 billion people worldwide are colonised by this parasite, and we believe that the majority experience no more episodes of intestinal upset, e.g. diarrhoea, than the average individual.

Blastocystis colonises the intestine for a long time (probably months or years).

Many species of Blastocystis are known, of which at least 9 have been found in humans. Such species are currently termed "subtypes" (STs). ST1, ST2, ST3 and ST4 are common in Europe. While ST1, ST2, and ST3 appear to have equal prevalences in patients with diarrhoea and healthy individuals, ST4 appears to be linked to diarrhoea and/or chronic conditions such as irritable bowel syndrome (IBS).

There is no known efficient treatment of Blastocystis. Although metronidazole is often prescribed for Blastocystis infections, there is conflicting reports on its efficacy. Even in combination with a luminal agent, such as paromomycin, Blastocystis eradication cannot be guaranteed.

Whether Blastocystis causes symptoms in humans may depend on factors such as co-evolution. ST3 is the most common subtype in humans and ST3 may account for 30-50% of Blastocystis in humans. ST3 shows substantial intra-subtype genetic variation, and we believe that Blastocystis ST3 has co-evolved with humans, and therefore we may have adapted to ST3 colonisation. ST4 on the other hand is almost clonal and may have entered the human population relatively recently. This could partly explain why ST4 colonisation has been linked to intestinal symptoms.

Further reading:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. ST4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea.