Showing posts with label subtypes. Show all posts
Showing posts with label subtypes. Show all posts

Thursday, November 10, 2016

This Month in Blatstocystis Research (OCT 2016)

A few things to highlight:

I'm very pleased to announce the Special Issue on Blastocystis recently appearing in Parasitology International - go here for the list of contents. The papers included in this issue represent the breadth of the contributions made to the 1st International Blastocystis Symposium, which took place last year in Ankara. A couple of review and opinion articles written by members of the Scientific Committee are accompanied by several articles outlining original research findings that were presented at the symposium. This special issue is particularly useful for younger researchers who wish to familiarise themselves with some of the methods that are currently in use in surveys of Blastocystis.
Readers should not expect to find articles on Blastocystis in a microbiota context; nor should they expect to see data from seminal studies that challenge the view that Blastocystis is a possible pathogen. Nevertheless, there is an interesting opinion paper with the title "Eradication of Blastocystis in humans--really necessary for all?"

Led by Dr Alison Jacob and Dr Graham Clark, London School of Hygiene and Tropical Medicine, our group just published an article on a comparative study of Blastocystis mitochondrial genomes. In general, mitochondrial genomes differ vastly in length, structure, and gene content across organisms, and by studying these genomes it has been possible to develop hypotheses on how these organisms have evolved including the adaptive/non-adaptive processes involved in shaping organismal and genomic complexity. Unlike most anaerobic eukaryotes, Blastocystis does not have true mitochondria but has mitochondrion-related organelles (MROs; also referred to as mitochondrion-like organelles [MLO]) that contain a genome. In the study in question, we sequenced and compared mitochondrial genomes from subtypes 1, 2, 3, 4, 6, 7, 8, and 9. All of them have the same genes in the same order, but two curiosities were noted. One gene, called orf160, as stop codons near the beginning of the coding region in most subtypes. A second gene, coding for ribosomal protein S4, lacks a start codon in some subtypes.
In both cases, these characteristics would normally prevent a gene from being expressed, but because these genes are otherwise conserved and most of the gene is 'intact', it seems likely that the genes are functional. Ribosomal protein S4 is considered an essential component of the ribosome needed for protein synthesis in the organelle. How the genes are expressed to produce functional proteins remains a mystery, - just one more peculiarity of Blastocystis!

In the growing pool of articles exploring relationships between intestinal parasites and gut microbiota, I was pleased to discover an article by Iebba et al. (2016) on "Gut microbiota related to Giardia duodeanlis, Entamoeba spp. and Blastocystis hominis infections in humans from Côte d'Ivoire". In this observational study, the authors used qPCR to detect groups of bacteria that are indicative of dysbiosis vs eubiosis, dysbiosis being a perturbed, imbalanced microbiota and eubiosis being a healthy, balanced gut microbiota. The authors found that individuals with Blastocystis and Entamoeba were characterised by eubiosis, while individuals with Giardia were characterised by dysbiosis. It says that samples (n = 20) were randomly chosen, but even so, the number of samples tested was low, and care should be taken when interpreting the results. The overall approach, however, is interesting, and somewhat resembles the work that we have been doing in our lab (ref). I also recently blogged about another study with a similar aim (go here to view the post).

I would also like to bring your attention to the EMBO Conference "Anaerobic protists: Integrating parasitology with mucosal microbiota and immunology", which will take place in Newcastle upon Tyne, UK in Aug/Sep 2017 (image). I will be there doing my best to deliver a stimulating talk on current knowledge and advances in Blastocystis and Dientamoeba research. You can visit the conference website by folloing this link

References:

Dogruman-Al F, Stensvold CR, & Yoshikawa H (2016). Editorial - PAR INT - special issue on Blastocystis. Parasitology international, 65 (6 Pt B) PMID: 27742000

Iebba V, Santangelo F, Totino V, Pantanella F, Monsia A, Di Cristanziano V, Di Cave D, Schippa S, Berrilli F, & D'Alfonso R (2016). Gut microbiota related to Giardia duodenalis, Entamoeba spp. and Blastocystis hominis infections in humans from Côte d'Ivoire. Journal of infection in developing countries, 10 (9), 1035-1041 PMID: 27694739

Jacob AS, Andersen LO, Pavinski Bitar P, Richards VP, Shah S, Stanhope MJ, Stensvold CR, & Clark CG (2016). Blastocystis mitochondrial genomes appear to show multiple independent gains and losses of start and stop codons. Genome biology and evolution PMID: 27811175

Smith DR (2016). The past, present and future of mitochondrial genomics: have we sequenced enough mtDNAs? Briefings in functional genomics, 15 (1), 47-54 PMID: 26117139

Saturday, January 30, 2016

This Month in Blastocystis Research (JAN 2016)

Three publications have caught my attention over the past month.

The first one is by my Turkish colleagues Kurt, Dogruman-Al, and Tanyüksel. They just published the paper "Eradication of Blastocystis in humans: Really necessary for all?" This title implies that treatment of Blastocystis is recommendable in some cases. The authors appear to acknowledge the view that treatment should be given to symptomatic carriers when all other causes of gastrointestinal symptoms have been rule out, - the popular 'last-resort' approach.

What I think is really useful and admirable is that the authors leave so many questions open/unanswered, despite the fact that they have been "in business" for so many years, representing some of the most avid Blastocystis researchers. It becomes clear from reading the paper that even in 2016, we still do not know how to eradicate Blastocystis from the intestine in those cases where we'd really like to try and do so. Importantly, the authors give examples of data supporting the fact that treatment failure may be due to failure of the drug to reach the parasite as well as treatment resistance. They also highlight the possibility that eradication of Blastocystis by antibiotic/anti-protozoal agents may be due to microbiota perturbation rather than a direct action on Blastocystis. I also very much appreciate the fact that the authors are embracing the necessity of studying Blastocystis in a parasite-microbiota-host context in order to be able to draw useful conclusions on its role in human health and disease.

Das and colleagues just published data on Blastocystis and subtypes of Blastocystis in IBS patients and controls in New Delhi, India. Using multiple traditional and DNA-based methods, they found that in their study material, the prevalence of Blastocystis was higher among patients with IBS than among healthy controls. It is not exactly clear how the controls were picked and what type of study population they represented. What I found really useful is the fact that they not only carried out subtyping of Blastocystis, but also identified subtype alleles. The subtypes and alleles found in the study were very similar to those found recently by Pandey et al. (2015) in Maharashtra, India.  Interestingly, it appears that only two subtypes are found in humans in India, namely ST1 and ST3. However, only two studies from India are available on subtypes in humans, to my knowledge, and so we need much more data to draw conclusions.

The last paper that I'm going to address is one by Zanzani and colleagues. When I read the abstract I almost dislocated my lower jaw from stupefaction: Studying the gastrointestinal parasitic fauna of captive non-human primates (Macaca fascicularis), they found a variety of protozoa and helminths, which is not surprising at all. Neither is it surprising that most macaques were positive for Blastocystis. Now, what really made my jaw drop was the fact their data on the subtypes found in the macaques challenged the host specificity of Blastocystis identified so far: They reported finding ST1, ST2, ST3, ST5, and ST7. And so, I had a closer look at the methods used to obtain data on subtypes. I take the liberty of questioning the data, since the authors report using a set of primers for amplification of Blastocystis DNA targeting the SSU rRNA gene, while using the STS primers developed by Yoshikawa et al. as sequencing primers! I guess that it is possible that the description of the methods was flawed (should have been picked up by the reviewer though), in which case I hope that an erratum will be developed and published.

References:

Das R, Khalil S, Mirdha BR, Makharia GK, Dattagupta S, & Chaudhry R (2016). Molecular Characterization and Subtyping of Blastocystis Species in Irritable Bowel Syndrome Patients from North India. PloS One, 11 (1) PMID: 26784888  

Kurt Ö, Doğruman Al F, & Tanyüksel M (2016). Eradication of Blastocystis in humans: Really necessary for all? Parasitology International PMID: 26780545

Pandey PK, Verma P, Marathe N, Shetty S, Bavdekar A, Patole MS, Stensvold CR, & Shouche YS (2015). Prevalence and subtype analysis of Blastocystis in healthy Indian individuals. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases, 31, 296-9 PMID: 25701123  

Zanzani SA, Gazzonis AL, Epis S, & Manfredi MT (2016). Study of the gastrointestinal parasitic fauna of captive non-human primates (Macaca fascicularis). Parasitology Research, 115 (1), 307-12 PMID: 26374536  

Yoshikawa H, Wu Z, Kimata I, Iseki M, Ali IK, Hossain MB, Zaman V, Haque R, & Takahashi Y (2004). Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries. Parasitology Research, 92 (1), 22-9 PMID: 14598169

Monday, October 5, 2015

This Month in Blastocystis Research (SEP 2015)

The month of September saw the publication of the first data on Blastocystis subtypes going out from Qatar. Abu-Madi and colleagues--who have already been quite prolific in terms of surveying intestinal parasitic infections in Qatar--studied the positive rate of Blastocystis in 608 apparently healthy subjects arriving in Qatar for the first time, identifying a prevalence of 71% as identified by PCR. Strikingly, the positive rate by microscopy of the corresponding samples was only 7%. Three subtypes were idenfied, with ST3 being the most common subtype, followed in prevalence by ST1 and ST2. The study is important for at least two reasons: It confirms the drawback of basing Blastocystis epidemiological research on data generated using microscopy alone, and it confirms the virtual absence of ST4 outside of Europe.

Increased sensitivity of PCR relative to microscopy was also confirmed in a study carried out in Malaysia (I presume) by Ragavan and colleagues. This group surveyed the Blastocystis positivity rate among IBS and non-IBS patients analyzing colonic aspirates, including a total of 109 individuals. Given the data available on Blastocystis prevalence, I was quite surprised to learn that this group failed to detect Blastocystis in any of the samples by microscopy and culture. Using PCR (the subtype-specific [STS] primers were used as diagnostic primers), the group identified Blastocystis in 6 IBS patients and 4 non-IBS patients. Also these figures appear quite low. However, there is very little information available on the non-IBS patients, and since all study individuals were subject to colonscopy, this group of individuals might be suffering chronic and potentially severe intestinal disease, including for instance colorectal cancer, inflammatory bowel disease, etc., which would explain the low prevalence of Blastocystis observed among these individuals. Indeed, evidence is accumulating that the more "gut healthy" you are, the larger the probability of being Blastocystis-positive. I noticed that the colonic aspirates were spun down using 3,000 rpm prior to culture and microscopy; this process might have had an impact on cell viability and morphology; still, DNA should be detectable following this process. Meanwhile, we recently showed (Scanlan et al., 2015) that the sensitivity of the STS primers is relatively low, which is why the use of real-time PCR is recommendable for PCR-based screening. To see an example of how the STS primers perform relative to barcoding primers, go here (Suppl Table 2).
Moreover, care should be taken when reading this paper, since I'm fairly convinced that the subtype terminology used in the study is different from the consensus terminology (Stensvold et al., 2007). It says that the subtypes detected included ST2, ST3, ST4, and ST5; if this reflects the terminology that went along with the original description of the STS primers, these subtypes correspond to ST7, ST3, ST6, and ST2, which to me would be a more likely subtype distribution, taking this particular region into consideration, and given the fact that ST5 appears to be extremely rare in humans. 

It's always interesting to expand on the natural host spectrum of Blastocystis. The parasite has been found in a perplexing array of hosts, but some host specificity has been observed. When it comes to animals held by humans as livestock or pets, we know that pigs and cattle are commonly, if not consistently, colonised by Blastocystis with some quite specific subtypes. With regard to pets, dogs and cats have been found positive, but there seems to be increasing evidence that these animals are not natural hosts (see also Wang et al., 2013). Osman and colleagues, recently published a survey on Cryptosporidium and Blastocystis in dogs using sensitive molecular methods, demonstrating a prevalence of Blastocystis of only about 3%. Moreover, the subtypes 2 and 10 were found, and ST10 is found mostly in cattle, and never before in dogs, as far as I know, which could suggest accidental colonisation - and possibly not a very long-lasting one. Similarly, when humans are found to be colonised with subtypes rarely found in humans, such as ST6, ST7, and ST8, it would be interesting to know for how long these subtypes are capable of "staying put" in the human intestine.

References

Abu-Madi M, Aly M, Behnke JM, Clark CG, & Balkhy H (2015). The distribution of Blastocystis subtypes in isolates from Qatar. Parasites & Vectors, 8 PMID: 26384209

Osman M, Bories J, El Safadi D, Poirel MT, Gantois N, Benamrouz-Vanneste S, Delhaes L, Hugonnard M, Certad G, Zenner L, & Viscogliosi E (2015). Prevalence and genetic diversity of the intestinal parasites Blastocystis sp. and Cryptosporidium spp. in household dogs in France and evaluation of zoonotic transmission risk. Veterinary Parasitology PMID: 26395822   

Ragavan, N., Kumar, S., Chye, T., Mahadeva, S., & Shiaw-Hooi, H. (2015). Blastocystis sp. in Irritable Bowel Syndrome (IBS) - Detection in Stool Aspirates during Colonoscopy PLOS ONE, 10 (9) DOI: 10.1371/journal.pone.0121173  

Scanlan PD, Stensvold CR, & Cotter PD (2015). Development and Application of a Blastocystis Subtype-Specific PCR Assay Reveals that Mixed-Subtype Infections Are Common in a Healthy Human Population. Applied and Environmental Microbiology, 81 (12), 4071-6 PMID: 25841010   

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Wang W, Cuttell L, Bielefeldt-Ohmann H, Inpankaew T, Owen H, & Traub RJ (2013). Diversity of Blastocystis subtypes in dogs in different geographical settings. Parasites & vectors, 6 PMID: 23883734

Saturday, February 28, 2015

This Month in Blastocystis Research (FEB 2015)

Before heading off to visit dear colleagues at the Public Health Agency of Sweden tomorrow morning, I thought I'd do a quick 'This Month...' post.

Tropical Parasitology has published a paper by Elghareeb and colleagues on  'Laboratory Diagnosis of Blastocystis in Diarrheic Patients'. I was asked to do a Guest Commentary on their paper, and if your're interested you can download my comments here for free (html version). The paper by Elghareeb et al. should also be free for download at the website.

I have been very lucky to work together with Dr Prashant K Pandey and his colleauges in Pune, India. Together we just published the first data on Blastocystis subtypes ever to appear in India for what I know. We subtyped Blastocystis in a cohort of healthy Indian individuals, and found ST1 and ST3 in 27/100 adult individuals tested, while other common subtypes, ST2 and ST4, were absent. Remarkably, ST3 was seen in all positive individuals, while ST1 was seen only in mixed infections. The strains (alleles) found in India were no different to those found in for instance Europe.

There is a paper out by Rossen and colleagues from The Netherlands showing that Blastocystis is relatively uncommon in patients with active ulcerative colitis (UC) and significantly less common in UC patients (13.3%) than in healthy individuals (32.5%). This is completely in line with data that we generated in Denmark a couple of years ago. In fact, at two separate occasions we have been able to look into patients with inflammatory bowel disease. In both cases (one study has been submitted for publication), hardly any Blastocystis was found in patients with Crohn's disease, while a few patients with UC were positive; however, mostly patients with inactive disease appeared to have Blastocystis, while those with flare-ups were negative. Therefore, the influence of dysbiosis on Blastocystis colonisation should be subject to further scrutiny.

A lot of action goes on at the official website for the 1st International Blastocystis Symposium in Ankara in May, with exactly three months to go! Why not take a minute to browse the programme for the Pre-Symposium Course and the Scientific Programme for the actual Symposium? Please go here to familiarise yourself with the new content. 
Also, conference abstracts are pouring in, - did you submit yours yet?

References

Elghareeb AS, Younis MS, El Fakahany AF, Nagaty IM, & Nagib MM (2015). Laboratory diagnosis of Blastocystis spp. in diarrheic patients. Tropical Parasitology, 5 (1), 36-41 PMID: 25709951

Stensvold, C. (2015). Laboratory diagnosis of Blastocystis spp Tropical Parasitology, 5 (1) DOI: 10.4103/2229-5070.149885  

Pandey PK, Verma P, Marathe N, Shetty S, Bavdekar A, Patole MS, Stensvold CR, & Shouche YS (2015). Prevalence and subtype analysis of Blastocystis in healthy Indian individuals. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases PMID: 25701123

Rossen NG, Bart A, Verhaar N, van Nood E, Kootte R, de Groot PF, D'Haens GR, Ponsioen CY, & van Gool T (2015). Low prevalence of Blastocystis sp. in active ulcerative colitis patients. European Journal of Clinical Microbiology & Infectious Diseases: Official Publication of the European Society of Clinical Microbiology PMID: 25680316

Thursday, April 10, 2014

Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.


The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC


What you'll see is this:


As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:



For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).




When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.