Showing posts with label subtyping. Show all posts
Showing posts with label subtyping. Show all posts

Friday, December 2, 2016

This Month in Blastocystis Research (NOV 2016)

Oftentimes, I receive emails from colleagues wanting to know how you subtype Blastocystis, how to grow them in culture, and how to freeze down cultures.

I'm very pleased to announce that Dr Graham Clark and I have developed protocols for exactly these activities and published them in Wiley's 'Current Protocols in Microbiology'; please go here for the subtyping protocol and here for the culture and cryopreservation protocols.
These should not only be seen as SOPs but also as a resource that enables standardization within the field.

Unfortunately, we have not yet come up with a protocol on how to axenise Blastocystis cultures, i.e., get rid of metabolically active organisms other than Blastocystis in cultures while keeping Blastocystis alive and multiplying.

We are well aware that many might not have access to these protocols because they haven't subscribed to Wiley Online Library; good news is that reprints will be available on request!


References:

Stensvold CR, & Clark CG (2016). Molecular Identification and Subtype Analysis of Blastocystis. Current Protocols in Microbiology, 43 PMID: 27858971  

Clark CG, & Stensvold CR (2016). Blastocystis: Isolation, Xenic Cultivation, and Cryopreservation. Current Protocols in Microbiology, 43 PMID: 27858970

Thursday, April 10, 2014

Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.


The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC


What you'll see is this:


As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:



For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).




When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.

Tuesday, April 1, 2014

This Month In Blastocystis Research (MAR 2014)

If there's one paper that really made my eye balls pop over the past 30 days, it's the paper appearing a couple of days ago in BMC Infectious Diseases by Safadi et al. on Blastocystis in a cohort of Senegalese children. The paper is open access and can be downloaded here. But I'll be jumping right at it:

A 100% prevalence of Blastocystis in a cohort of 93 Senegalese children! 

The children represented a mixed group of children with and without symptoms. And yes, they were all colonised!

Are Senegalese children obligate carriers of Blastocystis? Image courtesy of whl.travel.
I will not at all try and discuss the potential clinical implications of this. I don't think we currently have the appropriate tools to ascertain to which extent a 100% Blastocystis prevalence is a public health problem. 

However, technically and scientifically, I'm extremely pleased to see a study like this one. My group and some of my colleagues have somewhat similar data in the pipeline, and it's great to see this next generation of survey data emerging from different regions of the world, based on the use of highly sensitive molecular tools to screen for Blastocystis. I cannot emphasise the importance of this too much.

The authors hoovered faecal samples from the children for Blastocystis-specific DNA using both PCR + sequencing (barcode region) and real-time PCR. Importantly, quite a few samples negative by barcoding were positive by real-time PCR, and so if the authors had included only PCR + sequencing, the prevalence would have been only 75% or so. It may be not very surprising that barcoding PCR did not pick up all cases of Blastocystis, but then again, it has always been known that the barcoding PCR is not diagnostic - one of the primers, RD5, is a general eukaryotic primer, while the other one, BhRDr is Blastocystis-specific. Also, the PCR product is about 600 bp; diagnostic PCRs should preferably be designed to produced much smaller amplicons (100 bp or so) for a variety of reasons.

The research team subtyped all samples, and found ST3 to be the most prevalent subtype - colonising about 50% of the children. ST1 and ST2 were also common, while ST4 was found in only 2 children and only in mixed infections. Mixed subtype infections was seen in 8 cases. Note the small fraction of ST4. This subtype is very common in Europe but seems to be rare in most other regions.

There is no doubt that we with molecular tools are now starting to obtain data that represent a more precise snapshot of reality than before when tools of low sensitivity and unable to give strain information were used. And while qPCR can take us a long way in terms of precisely distinguishing positive from negative samples, we still have an amplification step that may interfere with the DNA information that we obtain. The French group involved in this study has over multiple studies done  an admirable job in terms of pursuing the extent of mixed subtype infections. Whether the data are based on sequencing of PCR products amplified by genus-specific primers, or whether real-time PCR  using genus-specific primers is used, it can still be argued that these methods have limitations due to application of genus-specific primers in both cases. It is going to be interesting to compare the evidence that we have collected from subtyping over the past few years with analysis of metagenomics data, which are independent of PCR amplification, and thus not subject to potential bias. 

A 100% prevalence means that transmission pressure is massive. Three subtypes are common. Still, mixed infections are present in less than 10%. If this is indeed a realistic picture, this may imply that once established, a Blastocystis strain is capable of keeping other strains at bay? In keeping with waht I said above, it is also possible that the extent of mixed infections is higher, and that the PCR methods only detect the more predominant strain, making the prevalence of mixed ST infection seem low.

It's tempting to believe that such a high prevalence of Blastocystis compared to Europe is due to exposure to contaminated water, but how does this explain a whopping 30% Blastocystis prevalence in the background population in Denmark, a country characterised by supreme hygienic standards and 'perfect plumbing' with all potable water being pumped up from the ground (ie. hardly no surface water)? Have all individuals positive for Blastocystis in Denmark been out traveling to more exotic countries with less well controlled water infrastructures? Or is Blastocystis just highly transmissible through e.g. direct contact? And will all who are exposed develop colonisation? What are the determinants? It's probably not fair to dismiss the idea of Blastocystis being waterborne (as one of the modes of transmission) due to the fact that Blastocystis has not been cause of waterborne outbreaks. If Blastocystis is non-pathogenic, it can easily be transmitted by water. In fact, if Blastocystis is waterborne and never gives rise to outbreaks, what does this tell us about it's pathogenic potential? Well, acute disease such as that seen for some bacteria, viruses, and Cryptosporidium, Giardia and microsporidia is probably not something that is associated with the organism.

I could have wished for allele analysis of the subtypes detected. It should be possible in all cases where barcode sequences were available, - simply and easy using this online tool. But the data is available in GenBank so everyone interested can have a look. 

There is plenty of interesting things to address, but for now I'll leave it here, and on behalf of all of us interested in Blastocystis research just thank the people behind the paper for publishing this important study!

And nope, this is no April Fool!

Literature:

El Safadi D, Gaayeb L, Meloni D, Cian A, Poirier P, Wawrzyniak I, Delbac F, Dabboussi F, Delhaes L, Seck M, Hamze M, Riveau G, & Viscogliosi E (2014). Children of Senegal River Basin show the highest prevalence of Blastocystis sp. ever observed worldwide. BMC Infectious Diseases, 14 (1) PMID: 24666632

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438

Friday, June 21, 2013

This Month In Blastocystis Research (JUN 2013)

Another paper in the string of publications coming out from the PhD study by Dr Alfellani (London School of Hygiene and Tropical Medicine) has just appeared in PubMed.

Dr Alfellani and his colleagues have done a great job in analysing a multitude of samples from humans, non-human primates and animals; I have previously blogged about their observations from studies of human and non-human primates. Moreover, they have surveyed available data in order to better discuss their own findings, and the work has contributed significantly to what today is known about the host specificity, genetic diversity, phylogeography and general molecular epidemiology of Blastocystis.

Alfellani's most recent paper is published in the journal Protist, and it deals with the 'Genetic Diversity of Blastocystis in Livestock and Zoo Animals'.

It is quite a large paper which includes a lot of new information and a comprehensive (and hopefully exhaustive) table summarising Blastocystis subtype data in all relevant hosts (humans, non-human primates, other mammals and birds).

I will highlight a couple of things from the paper:

1. Apart from reporting on virtually complete SSU rDNA sequences from a couple of subtypes for which entire SSU rDNA sequences have yet not been available, we also report on three novel subtypes. Until recently, we only knew about 14 subtypes (ST1-ST14), of which ST1-ST9 can be found in humans. Now, three additional subtypes have been identified; ST15 in artiodactyls (camel and sheep) and non-human primates (chimpanzee and gibbon), ST16 in kangaroos, and ST17 in gundis.

The Gundi (Ctenodactylus gundi) is a rodent living mainly in the deserts of Northern Africa. (Source)

2. Novel data arising from analysis of faecal samples from humans and animals in Sebha, Libya, strongly indicate that humans and animals in this area are infected by different subtypes: Humans appear to carry ST1, ST2, and ST3, while synanthropic animals (artiodactyls in this case) mostly have ST5 and ST10 infections, suggesting that livestock is not a major contributor to human Blastocystis infection.

To this end, there is growing evidence of quite a substantial degree of host specificity of Blastocystis.  Even when subtypes overlap between humans and animals, we have accumulating evidence that the strains found in humans and animals are different. This means that the hypothesis that animals constitute an important reservoir of human Blastocystis infections currently has very limited support. It is my clear impression that when a strain of ST6 or ST8 is detected in humans, this strain has most probably been transmitted from an animal source. But we very rarely see these subtypes in humans, at least in Europeans.

It will be extremely interesting to see how the universe of Blastocystis subtypes unfolds... by genetically characterising strains in humans and non-human hosts, we are building up a clearer picture of transmission patterns and evolutionary biology, including our adaptation to Blastocystis, and the parasite's adaptation to us and other hosts.

It is noteworthy that we are starting to see different subtypes in rodents. We have previously thought that generally, rodents were infected by ST4. But now we know that many rodents are not infected, and we also know that rodents may harbour subtypes other than ST4.

So,17 subtypes of Blastocystis are now known. We have probably only seen the top of the iceberg, since many host species have not yet been sampled from, and it is likely that we will see quite a few STs being identified in the nearest future. To this end it is necessary to have a consensus regarding the identification of novel subtypes. Along with the Protist paper we have uploaded a supplementary file (Appendix A, TXT format) with aligned reference sequences that can be used for phylogenetic analysis,  hoping that it will be useful to our colleagues. In a future blog post I will try to address the issues of identifying new subtypes more specifically.

ST15 is one of the more interesting subtypes since it appears to have quite a low host specificity - infecting both non-human primates and artiodactyls. Yet, we have come across it only now. ST15 and ST17 are remarkable in the way that they appear to be closer related to herptile and arthropod lineages, respectively, than to lineages from mammals.

Please note that virtually complete sequences of ST10, ST13, ST14, ST15, and ST17 analysed in the study have been released in GenBank just now.

Further reading:

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic Diversity of Blastocystis in Livestock and Zoo Animals. Protist, 164 (4), 497-509 PMID: 23770574

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980

Alfellani MA, Jacob AS, Perea NO, Krecek RC, Taner-Mulla D, Verweij JJ, Levecke B, Tannich E, Clark CG, & Stensvold CR (2013). Diversity and distribution of Blastocystis sp. subtypes in non-human primates. Parasitology, 140 (8), 966-71 PMID: 23561720

Thursday, May 9, 2013

YouTube Video on Blastocystis Subtyping

For those who want to venture into Blastocystis subtyping - the easy way - I've recorded and uploaded a video on YouTube fyi.




For even more information, please visit a selection of relevant blog posts here.

Saturday, February 2, 2013

Blog Feedback

I'm very thankful for all the positive feedback I get from readers across the globe, mostly by email. Due to time limits I can only respond to 5-10% of the mail, and I'm sorry for not getting back to the rest of you.

Meanwhile, this blog currently holds more than 60 posts, and you will also find a lot of key words in the right side bar, so take your time and browse a few posts or look up a few relevant key words, -  you might find an answer to one or more  of your questions.

Having said that, I try to read all my email, and I am listening! The feedback and questions that I get are vital for our work and help us identify the avenues that we need to take to unveil the many mysteries of Blastocystis.

And let me just say this for now: A proper microbiological work-up (by state-of-the-art methods, including PCR for intestinal parasites), is something that is offered on a routine basis in only very few laboratories, and also the number of clinically orientated Blastocystis research centres can be counted on one hand, I believe. Subtyping of Blastocystis is currently done mostly in epidemiological surveys (as part of research projects), and I suspect that our lab is one of the very few labs in the world doing subtyping on a routine basis.

Oh, and I've been asked by some readers about how to get blog updates. It's easy: You can follow this blog by email, - just scroll down and find "follow by email" in the right side bar and enter your email address. You can also subscribe to posts via atom (go to the very bottom of the page).

And then here's a little something about stomach acidity and intestinal microbiota from Scientific American, - but make sure to read the comments underneath the post too!
 

Saturday, January 5, 2013

Where Are We On Blastocystis Subtypes?

As mentioned, Blastocystis exhibits remarkable intrageneric diversity, which is continuously being explored by us and our colleagues. We are convinced that the genus of Blastocystis comprises multiple species, but for now we call them "ribosomal lineages" or "subtypes" and allocate numbers to each subtype, hence ST1, ST2, etc. While the number of subtypes that can be found in humans remains stable, we and our colleagues are still expanding the subtype universe in non-human hosts (I will be blogging on this shortly).

Barcoding currently represents state-of-the-art in Blastocystis subtyping, and luckily this method appears to gain a foothold in labs across the world.

Nine subtypes have been found in humans, but some of them only on rare occasions. A recent study going out from London School of Hygiene and Tropical Medicine and led by Dr Alfellani and published just now in Acta Tropica looked at 356 Blastocystis sequences from samples from the UK and Libya, but also from sub-Saharan Africa, namely Liberia and Nigeria.


Friday, August 10, 2012

Is This A New Subtype?

To quote one of my colleagues attending the recent IWOP 2012 meeting in Tarrytown, NY, Blastocystis subtyping in humans and animals is becoming 'trendy', and so we keep trying to advocate for a standardisation of the metholodology of Blastocystis subtyping.

We recently changed the title of our page at www.pubmlst.org/blastocystis so that now it is called Blastocystis Subtype (18S) and Sequence Typing (MLST) Databases, and we added some text to front page:

In terms of genetic markers, the barcode region (Scicluna et al., 2006) is by far the best represented in publicly available sequence databases, and the correct subtype can be identified by BLAST analysis in the sequence database at the present site. Blasting against this database has the added advantages, compared to using GenBank, of automatically assigning allele types to the SSU-rDNA as well as using the consensus subtype nomenclature (unlike GenBank where the subtype is included only if one was part of the accession submission and no attempt to impose a standard nomenclature is made). In case the sequence does not match any of the ones in the database despite full coverage of the region, this indicates that the sequence represents a new allele or maybe even a new subtype depending on the amount of variation. If a new subtype is suspected, we suggest doing PCR and sequencing of the complete SSU rRNA gene with subsequent phylogenetic analysis using reference sequences.

Now, the last bit is extremely important. We have seen examples of researchers (including ourselves!) assigning sequences to a new a subtype in the absence of complete SSU rDNA data (in fact complete sequences for ST10-ST14 are not yet publicly available!). Doing so has a least two major limitations/drawbacks: Far from all SSU rDNA regions have been validated as being representative of the whole SSU rRNA gene in terms of phylogenetic analysis, and therefore phylogenetic inferences based on non-validated regions may have little or at least less support than anticipated. Moreover, if someone analyses e.g. position 600-1600, and phylogenetic analysis based on this region reveals a potentially new subtype, this makes it impossible for his/her colleague who has data covering positions 1-600 from a Blastocystis isolate that may also represent a new subtype to ascertain whether it might be same subtype (see example below)!

Obtaining complete SSU rDNA sequences directly from faecal DNA may be a cumbersome task but is sometimes possible by combining sequence-specific primers with low-specificity primers such as the RD5 and the RD3 primers (Clark, 1997). If a cultured isolate is available, obviously this makes complete SSU rDNA sequencing much easier.

While it appears that the number of subtypes occurring in humans stays around 9, our gut feeling is that we are yet to uncover quite a few subtypes colonising non-human mammals, and it's great to see an increasing number of teams exploring the genetic diversity of Blastocystis. For instance, Dr Ronald Fayer and his group recently published exciting data on a new Blastocystis subtype in cattle, which they named ST14 (Fayer et al., 2012).

Importantly, caution should be taken to avoid creating confusion in subtype terminology. Confusion can arise when independent researchers assign the same new subtype name (e.g. ST14, ST15, etc.) to novel sequences which in fact belong to different ribosomal lineages, or when incomplete SSU rDNA sequence data are used; this situation was seen recently, when Petrasova et al. (2011), assigned a Colobus sequence to ST5, although it was in fact a ST13 sequence (Clark et al., in press); the situation arose, since Petrasova et al. (2011) did not have data covering the region currently available for ST13 (Parkar et al., 2010), and therefore believed that their sequence was a unique ST5 variant. As for ST14, less than 500 bp are currently available, and these 500 bp are not in the barcode region, making it difficult for all teams using barcoding to compare their data. And so we would like to advocate for making complete SSU rDNA sequences publicly available (Genbank) for potentially new subtypes, for at least two reasons:

1. Phylogenetic inferences based on the complete SSU rDNA will be more robust than those obtained from analysing shorter sequence streches.

2. Complete seqeunces are needed for reference since subtype screening typically includes a single round PCR such as barcoding (Scicluna et al., 2006) amplifying about 550 bp; in the situation where complete SSU rDNAs are available for all known subtypes, it will be quick to analyse, whether a sequence may represent a new subtype, since this will be independent on the SSU rDNA region studied.We therefore hope that complete SSU rDNA sequences will soon be made publicly available for ST10-ST14.

So, when does a complete SSU rDNA sequence represent a new subtype? Well, we have a review paper in press in Advances in Parasitology on recent developments in Blastocystis research, which will be published in less than six months probably, and which also touches on this topic; once the paper is published, I will try and make a summary our thoughts on this...

Further reading:


Clark CG (1997). Extensive genetic diversity in Blastocystis hominis. Molecular and biochemical parasitology, 87 (1), 79-83 PMID: 9233675

Fayer R, Santin M, & Macarisin D (2012). Detection of concurrent infection of dairy cattle with Blastocystis, Cryptosporidium, Giardia, and Enterocytozoon by molecular and microscopic methods. Parasitology research PMID: 22710524

Parkar U, Traub RJ, Vitali S, Elliot A, Levecke B, Robertson I, Geurden T, Steele J, Drake B, & Thompson RC (2010). Molecular characterization of Blastocystis isolates from zoo animals and their animal-keepers. Veterinary parasitology, 169 (1-2), 8-17 PMID: 20089360

Petrášová J, Uzlíková M, Kostka M, Petrželková KJ, Huffman MA, & Modrý D (2011). Diversity and host specificity of Blastocystis in syntopic primates on Rubondo Island, Tanzania. International journal for parasitology, 41 (11), 1113-20 PMID: 21854778
 
Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of blastocystis. Protist, 157 (1), 77-85 PMID: 16431158

Wednesday, May 2, 2012

Blastocystis Sequence Typing Home Page

Last year, we launched the Blastocystis Sequence Typing Home Page, which is a publicly accessible resource including two major facilities: 1) A sequence database and 2) An isolate database.
The databases cover both SSU-rDNA data and Multilocus Sequence Typing (MLST) data. For those interested in MLST, please visit this paper.The rest of this post will be about SSU-rDNA sequences.

The database has a BLAST function. Barcoding sequences (i.e. sequences which include the 500 5'-most bases in the SSU-rDNA) can be submitted individually or in bulks, and the output file will include information on subtype (ST) and allele. The number of alleles in ST3 is huge (currently n=38) compared to other subtypes, for which only 2-3 alleles have been identified (e.g. ST8). In case a sequence is submitted that is not similar to an allele already present in the database, I suggest that you do an individual sequence query, which enables the generation of an alignment, which will show you the polymorphism(s). In case a new allele is identified, I suggest that we submit this new allele to the sequence database.
We not only strongly encourage using this BLAST feature for quick and standardised subtype and allele identification, but also for submitting isolate data, i.e. barcode sequences with provenance data (data on host, symptoms, geographical origin, etc.); again this can be done by contacting the curator (me); please look up the site for more information.

Our goal is to produce a database which accommodates large sets of data that can be submitted to scrutiny by everyone. The isolate database currently holds almost 700 isolates with 118 unique alleles - I hope this can be expanded much, much more. Also, data extracts can be done at all times, and below is a random example of an extract from human and non-human data from France downloaded from GenBank:
The colours indicate different alleles in different hosts (see legend to the right). A file with all alleles in fasta format is available here. You can paste them into the search field here for a total list of alleles currently in the database; try clicking on a couple to familiarise yourself with the system... One of the things that we can see here is that alleles 34, 36, 37 (ST3) and allele 4 (ST1) are the most common alleles in humans in France. It may seem a bit confusing to speak of both subtypes AND alleles. However, alleles are a good proxy for MLST data, and hence, looking at alleles is useful, e.g. in terms of transmission studies.

There are many other ways of extracting and visualising data from the isolate database. For more information on barcoding, subtypes, alleles, and the databases, please do not hesitate to contact me. I emphasise that the database only works with sequences that include the barcode region; mutliple SSU-rDNA targets have been used for subtyping, but due to the fact that this database is based on barcode data, we recommend that subtyping be done by barcoding (see references).

Useful literature:

Stensvold, C., Alfellani, M., & Clark, C. (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes Infection, Genetics and Evolution, 12 (2), 263-273 DOI: 10.1016/j.meegid.2011.11.002  

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158

Wednesday, April 18, 2012

Blastocystis Subtyping in Routine Microbiology Labs

When I speak to colleagues in and outside Europe and visit research portals and social media, including Facebook groups, I get the impression that Blastocystis subtyping is something that is still very rarely done, despite the fact that most clinical microbiologists and biologists acknowledge that subtypes may differ in terms of clinical significance and in other respects. We get new data on Blastocystis subtypes in various cohorts from time to time from research groups around the world, but all reports are characterised by relatively small sample sizes and subtyping methodology has not yet been standardised. This type of research is moreover challenged by the fact that Blastocystis is common in healthy individuals (i.e. people not seeing their GPs for gastrointestinal problems), and this makes it extremely difficult to identify the subtype distribution in the "background" population.

Although we recommend barcoding (see one of my previous posts) as the subtyping method of choice, there is no "official report" identifying the Blastocystis subtyping gold standard. Therefore, I'm currently setting up a lab project that is going to help us compare the most common methods used for subtyping in order to identify the one most suitable. I emphasise that the best method used for subtyping is not the PCR that should be used for diagnostic purposes, mostly due to the fact that PCRs for subtyping amplify 300-600 bp, which are much longer amplicons than the one we go for in diagnostic PCRs (typically 80-100 bp). We therefore recommend our novel TaqMan-based real-time PCR for initial diagnosis, or culture, which is inexpensive and relatively easy and provides you with a good source of cells for DNA extraction.
I hope that we will be able to come up with some robust data soon that will allow us to recommend the most suitable approach and hope to publish our results in a clinical microbiology journal of high impact, and I hope that this will prompt Blastocystis subtyping in many labs. Once this report has been published, I intend to upload a protocol here at the site where lab procedures for diagnosis and subtyping will be described in detail. Stay tuned!

Thursday, April 12, 2012

On Subtypes, Genotypes, Alleles and Sequence Types (SQTs)

There has been some confusion about Blastocystis "subtypes" and "genotypes". 

Often, these two terms have been used interchangeably. While “subtype” refers to a distinct ribosomal lineage (which in the case of Blastocystis may very well be a distinct species), “genotype” denotes variation WITHIN subtypes. 

Currently, there is no clear definition of genotypes in Blastocystis. Based on phylogenetic analysis of barcode sequences of ST4, the existence of two genotypes in ST4 has been mentioned (Stensvold et al., 2011).  

Based on markers in the mitochondrion-like organelle of Blastocystis, we recently developed MLST assays for ST3 and ST4 and published data on intra-subtype variation in these two subtypes (Stensvold et al., 2012). While 58 sequence types (SQTs) were found among 81 ST3 isolates, only 5 SQTs were found among 50 ST4 isolates. 

By comparing SQTs with barcode sequences, we discovered that barcode sequences belonging to the same subtype may display intra-subtype diversity, and we found out that barcode sequences can be seen as valid proxies for SQTs. We have chosen to use the term "allele" to enable denotation of variation in barcode sequences. Currently, we have discovered 38 ST3 alleles (i.e. 38 different ST3 barcode sequences) as opposed to 8 different ST4 alleles. There are still no published data on ST1 and ST2 SQTs, but given the fact that 22 different alleles have been discovered so far for each of these two subtypes, we may expect a substantial number of SQTs.

The world of Blastocystis terminology and subtyping, etc. may seem a bit overwhelming and at times confusing, but believe me, - much has improved since 2006, when Blastocystis terminology was completely up in the air! 

For more information or further clarification, please don't hesitate to contact me.

Cited literature:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol. 2012 Mar; 12 (2) :263-73. PubMed PMID:22116021.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. subtype 4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea. Am J Trop Med Hyg. 2011 Jun; 84 (6) :883-5. PubMed PMID:21633023; PubMed Central PMCID: PMC3110361.

Tuesday, April 3, 2012

Blastocystis Subtyping - Easy Peasy!

If you are a student or young scientist interested in intestinal parasites and/or infectious disease/molecular epidemiology, why not take to Blastocystis subtyping? It's easy, quick, cheap, and you are guaranteed results. You don't have to sit around and wait for positive samples.
And, best of all: Your data will make a difference!

Once you have your "barcode" sequence(s), you just paste them into the box as described below in the post "Is Blastocystis Zoonotic?", and you will get subtype and allele data right there, without having to consult other resources. However, we recommend that you familiarise yourself with essential papers such as 

Noel et al. (2005)
Scicluna et al. (2006)
Stensvold et al. (2007)

So, how do you get your sequences? Well, you can use DNAs extracted directly from faecal samples (faecal DNAs) or from cultures (I will soon post a note on Blastocystis culture). Multiple PCRs have been described for genetic characterisation of Blastocystis, and most of them target the small subunit (SSU) rRNA gene (18S).

For a variety of reasons (which we are currently listing in an upcoming review - watch out for it!), we recommend using the barcoding approach launched by Scicluna et al. (2006). The RD5 primer combined with BhRDr amplifies a region of approximately ~600 bp, which is usually sufficient to distinguish between subtypes.

Substantial sampling has been done in Europe, while data from Sub-Saharan Africa and the Americas are scarce. Sampling from animals is also highly warranted, especially from rodents, since this group appears to constitute a potential reservoir for human ST4.

In your search for subtypes, it is not unlikely that you will stumble upon what appears to be a new subtype, especially if you are analysing samples from animals. In that case, we recommened that you sequence the entire SSU rRNA gene. Using faecal DNA, this can be challenging (but possible!), so if you have the isolate in culture, then DNA should be extracted from the isolate and used instead to save money and effort. We are about to come up with some thoughts on how to determine whether a sequence represents a new subtype. Stay tuned!