Showing posts with label epidemiology. Show all posts
Showing posts with label epidemiology. Show all posts

Wednesday, March 1, 2017

Blastocystis PhD thesis from Iraq

My colleague, Dr Haitham Sedeeq Albakri (Assistant Professor at Department of Microbiology, College of Veterinary Medicine, University of Mosul), recently defended his PhD thesis  on 'Isolation and Genotyping of Blastocystis hominis in Human and Different Animals in Erbil Province'. His work was supervised by Prof Dr Abdul Aaziz Jameel Al-Ani.

Haitham wrote me and asked if I could publish the summary on my website, so here goes:



Blastocystis is an enteric unicellular anaerobic protozoan that presents in the digestive system of the humans and different animal hosts including cattle, sheep, goats, pigs, dogs, cats and birds as well as wild animals. Blastocystis causes digestive system disorders especially the irritable bowel syndrome, while animals are considered as reservoir and infective hosts. In Iraq, few morphological studies related to Blastocystis have been done in human only, but not animals. Therefore, the study aimed to detect the presence of Blastocystis in human and animal hosts, in addition to study the morphological and genetic characteristics of this protozoan. In this present study, a total of 292 stool samples have been examined for the presence of Blastocystis, the samples were distributed as follows: humans 62, cattle 81, sheep 78, dogs 21 and cats 50. Wet mount preparation, trichrome staining and culture methods were used to study the morphological characteristics of Blastocystis. In addition, molecular characteristics have been studied by polymerase chain reaction (PCR) using universal primers to detect the presence of the Blastocystis, and subsequently subtyping of positive samples using 10 pairs of subtype-specific primers. Blastocystis also have been characterized by restriction fragment length polymorphism (RFLP) method using HinfI. Finally, DNA barcoding method has been used as a more accurate and recommended method for subtyping. The results showed that Blastocystis has been detected using wet mount preparation method in 71 (24.3%) out of 292 samples collected from all hosts including human, cattle, sheep dogs and cats. While 17/62 (27.4%), 19/81 (23.5%), 14/78 (17.9%), 3/21 (14.3%) and 18/50 (36.0%) samples were positive in human, cattle, sheep dogs and cats, respectively. The detection percentages were higher when culture method was used and 98 (33.6%) were positive out of 292 tested samples. While 28/62 (45.2%), 31/81 (38.3%), 25/78 (32.1%), 2/21 (9.5%) and 12/50 (24.0%) samples were positive in human, cattle, sheep dogs and cats, respectively. The molecular methods revealed that all cultured samples were positive using universal primers with product size 1780 bp. While positive samples subtyped using specific primers into ST3a and ST3b in humans, ST5 and ST6 in cattle and ST6 in sheep, ST1a in dogs and ST5 in cats. The RFLP technique classified the Blastocystis into seven genotypes; type I, II and III in humans, type IV, V and VI in cattle and only one type, VII, in sheep. Whereas, DNA barcoding method showed that ST2 and ST3 present in humans, ST14 in cattle and ST5 in sheep, these subtypes represent 9 isolates of Blastocystis sp. that have been successfully submitted to the GenBank of the NCBI, including 4 isolates in human, 2 isolates in cattle and 3 isolates in sheep. In conclusion, this is the first morphological and genetic study of Blastocysts in humans and animal hosts in Iraq. It is also the first time that culture method has been used in Iraq for diagnosis of this protozoan. Additionally, it is the first time that molecular characterization of different local subtypes has been confirmed in Iraq. Further studies are needed to include morphological and genetic characteristics in other animal hosts and to study the relationship between human and animal isolates in different geographical areas in Iraq, in addition to investigate the relation between Blastocystis with irritable bowel syndrome in humans.



I believe that this is the first study to include Blastocystis subtype data from Iraq. I also believe that the thesis was written mostly in Arabic. Dr Albakri's email address is haitham_albakri[at]yahoo.com

Monday, August 1, 2016

This Month in Blastocystis Research - Interactive Edition

What are your thoughts on Blastocystis carriage and age?

More and more data suggest that the prevalence of Blastocystis carriage increases by age - at least to a certain point.

Some intestinal parasites, such as Cryptosporidium, may not be that uncommon in infants/very young toddlers, while they are much less common in older children and adolescents. Other parasites appear to peak in prevalence around the age of 7, e.g., Dientamoeba fragilis.

Meanwhile, Blastocystis appear to increase in prevalence by age until mature adulthood... why is that? And what does it tell us? Please comment! I'm not having all the answers to these questions myself, and if some interesting suggestions pop up, I'll post them! You only need a Google account to be able to comment. If you don't have one, please send your comment using

crs[at]blastocystis.net 

For those interested in Blastocystis carriage in association with age, I have listed a couple of relevant recent studies below.

References:

Forsell J, Granlund M, Samuelsson L, Koskiniemi S, Edebro H, & Evengård B (2016). High occurrence of Blastocystis sp. subtypes 1-3 and Giardia intestinalis assemblage B among patients in Zanzibar, Tanzania. Parasites & Vectors, 9 (1) PMID: 27356981  

Poulsen CS, Efunshile AM, Nelson JA, & Stensvold CR (2016). Epidemiological Aspects of Blastocystis Colonization in Children in Ilero, Nigeria. The American Journal of Tropical Medicine and Hygiene, 95 (1), 175-9 PMID: 27139454

Tuesday, December 1, 2015

This Month in Blastocystis Research (NOV 2015) - Persian Gulf Edition

Today is the first time an Airbus A380 will be landing in Copenhagen Airport, Denmark. Flying in from Dubai, it will mark the inauguration of a runway that was recently refurbished to enable accommodation of a plane of this size.

I therefore thought I'd make a tribute to this particular day by dedicating the "This Month in Blastocystis Research" post to studies on Blastocystis recently published by researchers based along the Persian Gulf. Three surveys on Blastocystis from this region recently made it to parasite/microbiology research journals. The studies are important since they represent examples of studies employing molecular tools for screening and molecular characterisation of parasite isolates identified in regions where such data are extremely scarce. Some of these data will enable us to better understand host specificity, differences in geographic distribution, clinical and public health significance, and transmission patterns.

 The first study was on Blastocystis in Qatar and published in Acta Tropica; it was already mentioned in my September blog entry.

I was lucky to be involved in the second study, which was a study carried out in Sharjah, United Arab Emirates, and designed by Ali ElBakri and colleagues. In this study, we screened a total of 133 samples from ex-pats living in Sharjah, subtyping the samples positive for Blastocystis using partial small subunit (SSU) ribosomal RNA gene sequencing. Fifty-nine (44.4%) samples were positive, of which 39 were successfully sequenced and subtyped. The ST distribution was as follows: ST3, 58.9% (23/39); ST1, 28.2% (11/39); and ST2, 7.6% (3/39). This study is the first to provide data on the prevalence of Blastocystis and the distribution of various STs in the UAE. As usual, ST4 was absent, while ST1, ST2, and ST3 were all common in this geographical region; a situation similar to most other regions outside of Europe.

The third study was from the city of Baghmalek in Southwestern Iran, and was published by Khoshnood and colleagues in Jundishapur Journal of Microbiology. This team used microscopy to identify Blastocystis in 1,410 stool samples from patients presumably suffering gastrointestinal symptoms. A very low prevalence was identified, about 3%. This low figure most likely reflects the use of microscopy, which is an extremely insensitive diagnostic method. From Blastocystis-positive samples, DNA was extracted and submitted to PCR and sequencing targeting the (SSU) ribosomal RNA gene. It says in the article that the subtypes identified in the study included "ST3, ST4, ST5, and ST7 with the most prevalent being ST4 (40.9%)", and the main conclusion is that, unlike the situation in other countries in the Middle East, ST4 was identified as the most prevalent subtype.

There are at least two conspicuous situations here: The first one pertains to the rather unusual subtype distribution reported, which appears quite dissimilar to the ones reported from neighbouring countries. The next one is even more odd and pertains to the fact that the sequences (AB915194 - AB915214) generated in the study, and from which the subtype data must have been inferred, do not BLAST to other nuclear ribosomal RNA genes in GenBank, of which there are thousands! In fact, AB915194 represents a protein-coding gene, translating into  

S P Y L L S I S T E E S Y T D S H Y Y G E C T T I A Q S I Y H Q S S K S V E A S I W D C V Y Met T L I Y E G V T D L T Y D E M K A S Y T D P V E T L T V L G K Y P G A D I S G I S L D L V F G Y I G R G I P V I S R I N D G R Y V L I V S Y N S E A V R Y Y D P V L D E Q V R K Q

... which is a Clostridium hypothetical protein with a peptidase domain! This may either reflect an error linked to the accession numbers, or it may reflect a situation where for some reason non-ribosomal DNA sequences were uploaded to GenBank. Given the appearance of the phylogeny included in the article, it could easily be suspected that the sequences produced and used were in fact non-Blastocystis DNA sequences, in which case the paper should be retracted. Before this mystery has been solved, the results of the Iranian study cannot be fully appreciated, and the relevance of citing the study appears very limited for now.

The last study highlights the importance of making sequence data publicly available; if these data had not been available for critical appraisal, the conclusions made in this article could easily have been accepted without any further ado!

References:

Abu-Madi M, Aly M, Behnke JM, Clark CG, & Balkhy H (2015). The distribution of Blastocystis subtypes in isolates from Qatar. Parasites & Vectors, 8 PMID: 26384209

AbuOdeh R, Ezzedine S, Samie A, Stensvold CR, & ElBakri A (2015). Prevalence and subtype distribution of Blastocystis in healthy individuals in Sharjah, United Arab Emirates. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases PMID: 26611823 

Khoshnood S, Rafiei A, Saki J, & Alizadeh K (2015). Prevalence and Genotype Characterization of Blastocystis hominis Among the Baghmalek People in Southwestern Iran in 2013 - 2014. Jundishapur Journal of Microbiology, 8 (10) PMID: 26587213 

Thursday, April 10, 2014

Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.


The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC


What you'll see is this:


As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:



For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).




When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.

Friday, December 20, 2013

Blastocystis Highlights 2013

For decades man has striven to improve sanitation and protect production animals and crops from infectious agents to prevent diseases in humans, animals and plants. We tend to eat highly processed foods and many children grow up in almost sterile surroundings, for instance without contact to animals. Consequently, in developed parts of the world we are much less exposed to microorganisms and helminths than previously, and the extensive use of antibiotics for prevention, treatment and control of microorganisms is well-known.

As we are now starting to get a much deeper understanding of the role of the human microbiome (whatever that is) in health and disease, we become aware that microbes are to a large extent beneficial to us; for instance we are currently realising that human health is more or less proportional to intestinal biodiversity, including colonisation by parasites. I have previously mentioned the intentional use of eggs of the parasite Trichuris suis to alleviate symptoms and maybe even reduce disease processes in inflammatory bowel disease, a disorder seemingly stemming from immunological processes out of balance. Also in the food sector, steps may now be taken to diminish breeding and gene manipulation to increase crop yield; instead manipulation of microbes (e.g endophytes) may be used to makes crops hardier. Using microbes to combat other microbes and disease processes, thereby reducing the use of antibiotics and other chemical compounds will probably - and hopefully - be central to controlling diseases and increasing production yields.

For us in the 'Blasto business' these trends are particularly intriguing. I'm not the only one who just a couple of years ago thought that functional bowel disorders such as irritable bowel syndrome (IBS) to a large extent might be directly attributable to undiagnosed parasite infections (e.g. Blastocystis and Dientamoeba), something that could be supported by data going out from one of the studies that I carried out during my PhD studies. Over the years, however, we and other groups have produced data showing that patients with IBS are in fact significantly less colonised by the microbial eukaryotes Blastocystis and Dientamoeba than the healthy 'background' population (see this blog post). We also have access to metagenomic data that link the presence of these microbial eukaryotes with high bacterial diversity in the intestine, and I have colleagues confirming that patients suffering post infectious IBS-like symptoms do practically not harbour these parasites. Our hypothesis now is that - generally speaking - Blastocystis and Dientamoeba are proxies for high intestinal microbial diversity and thereby for a healthy gut ecology. This does of course not rule out the possibility of pathogenic strains/subtypes/whatever of microbial eukaryotes, and we are currently increasing our efforts to investigate whether these organisms can cause disease directly or indirectly, - I'll post a few lines on some of the work we have in mind for 2014 in my next post. I believe that one of the things that most Blastocystis researchers are interested in currently, is to increase our knowledge on the diversity and biological characteristics of mitochondrial and nuclear genomes.

It takes time to produce, analyse and interpret genomic data on Blastocystis, simply because we have so little money that can be allocated to PhD students and post docs. Although we try hard to get funding, we only have one PhD student working with Blastocystis genome data... I could have wished for at least one more. One year ago, I thought that 2013 would see at least one more Blastocystis genome paper, but so far, only very little data have emerged and only included in conference abstracts. But so far it appears that the genetic universe of Blastocystis is even bigger than most of us may have thought! To get a very preliminary impression of their data and how much ST1 differs from ST7 (currently the only available genome), you may want to visit a previous blog post. This basically means that even though we know about genes present and expressed by one subtype, the situation may be completely different for other subtypes! Very interesting, but it also means that a lot of work remains to get a clear picture of what Blastocystis actually does and is capable of doing.

This year was also the year where three seminal papers came out from London School of Hygiene and Tropical Medicine, all of them first authored by Dr Mohammed Alfellani, who did a magnificent job collecting, culturing and 'DNA extracting' samples from both humans, non-human primates, and other animals from various geographic regions. I have already given numerous examples of his findings. Dr Alfellani identified new subtypes, and did a great job in identifying remarkable variations in the geographical distribution of subtypes in both humans and animals. There are also some useful tables in Alfellani's papers showing overviews of molecular data produced by him and our colleagues. We definitely hope that his papers will stimulate other colleagues to pursuing the epidemiology of Blastocystis and should definitely hold some useful tools for those who are new to Blastocystis epidemiology research. 

I had the pleasure to write up a paper to Trends in Parasitology together with Dr Pauline Scanlan. The paper was free for download in November, and we received quite a lot of positive feedback, so thank you all who are so supportive of the work! It was also very rewarding to put together a review for Advances in Parasitology together with Drs Alfellani, van der Giezen and Clark on 'Recent Developments in Blastocystis Research'.

2013 was also the year where my SSI colleagues and I published a comment in the ISME Journal on how impatiently we are awaiting data on the human 'eukaryotic' microbiome. To map the microbial eukaryotes of the intestine and to try and characterise their structure and function and the intestinal ecology that accompany these organisms are activities that should receive top priority in my opinion. There is a link to the comment here.

Congress-wise, I experienced my first-time-ever Blastocystis session at a conference! It was at the merged meeting arranged by the Scandinavian-Baltic Society for Parasitology and the European Society for Tropical Medicine & International Health. Next year, I will be involved in the session 'Passion for Parasites' at the general ASM 2014 meeting in Boston (morning session,18th of May 2014), where I'll be giving a talk on Blastocystis, and, later next year, I will also be leading a lecture/workshop associated with the ICOPA conference in Mexico on Blastocystis barcoding, - I hope to see a few upcoming Blastocystis geeks there!

I don't think we have ever had better opportunities to do significant research on Blastocystis. More and more people are working with it, our epidemiological data have become a lot stronger, enabling more subtle hypotheses, lots of strains have been sequenced, we have developed protocols for experimental in-vitro and in-vivo studies, so here's to hoping for a vast increase in funding and work in 2014!

Attaching an image of the Nutcracker display currently adorning the facade of the Hotel d'Angleterre in Copenhagen, I wish all of the readers of this blog a Merry Christmas and a Happy New Year!



Literature:

Nicola Jones (2013). Food fuelled with fungi. Nature, 504 DOI: 10.1038/504199a

Friday, November 22, 2013

Do IBS Patients Lack Blastocystis and Dientamoeba??

I feel like sharing data from a poster created by one of my colleagues, Dr Laura Rindom Krogsgaard who works at Køge Sygehus, Denmark. She presented the poster last month at the United European Gastrointestinal (UEG) Week in Berlin.

Laura is currently doing a very interesting survey on IBS and IBS-like symptoms in Danish individuals. Her first publication was on the epidemiology of IBS in Denmark (see literature list below). She performed a web-based survey, using YouGov Zapera, and questionnaires were emailed to a web panel (n = 19,567) representative of the general Danish population aged 18-50 years containing info on gender, age, geography and type of intestinal symptoms (if any). IBS and subtypes were estimated by the Rome III criteria. Of 6,112 responders, 979 (16%) fulfilled the Rome III criteria for IBS and had no organic diagnosis likely to explain their symptoms. IBS subtypes detected included  mixed IBS (36%), IBS with diarrhea (33%), IBS with constipation (18%), and unsubtyped IBS (11%).

At the Laboratory of Parasitology, we helped Laura analyse stool samples from survey participants for parasites. Not surprisingly, Blastocystis and Dientamoeba were by far the most common parasites detected; however, it appeared that individuals with IBS symptoms were less likely to be colonised by these parasites than their controls! Which means that we have a situation reminiscent of that seen in IBD patients, only less pronounced. 

Laura was able to survey symptom developement over 1 year and compare this to the incidence of Blastocystis and Dientamoeba, and none of the parasites (indvidually or in co-infection) were linked to symptom development.

Indeed, Laura's data are in line with the general tendency that we see for Blastocystis (see figure below). Blastocystis appears to be rare in individuals with perturbation of the intestinal microbiota (due to antibiotic treatment, inflammation, infection, diet, etc.), while common in healthy individuals, most of whom are probably characterised by high gut microbial diversity and thereby - apparently - the right substrate/growth conditions for Blastocystis.


Literature:

Krogsgaard LR, Engsbro AL, & Bytzer P (2013). The epidemiology of irritable bowel syndrome in Denmark. A population-based survey in adults ≤50 years of age. Scandinavian Journal of Gastroenterology, 48 (5), 523-9 PMID: 23506174

The entire poster "Dientamoeba fragilis and Blastocystis: Two parasites the irritable bowel might be missing" presented at the UEGweek can be viewed here via SlideShare.


Wednesday, October 16, 2013

Dying to know about Dientamoeba?

It's difficult to say 'Blastocystis' without saying 'Dientamoeba fragilis'. Both parasites tend to be extremely common in countries where other intestinal parasites (e.g. Entamoeba, Giardia, Cryptosporidium) are of low endemic occurrence, and they are often seen together in patient samples. It is only due to the recent introduction of DNA-based diagnostic methods (PCR) that we now know that these parasites are much more common than previously anticipated.

So, while I'm trying to encourage guest bloggers, I thought I'd introduce a 'guest star' - Dientamoeba!

Dientamoeba fragilis trophozoites with the characteristic binucleated feature.
The parasite belongs to the trichomonads, which also comprise parasites such as Histomonas meleagridis (the cause of 'blackhead disease' in turkeys) and - more distantly - Trichomonas vaginalis.

At our Parasitology Lab at Statens Serum Institut in Copenhagen we have been using real-time PCR for specific detection of Dientamoeba fragilis in faecal samples from patients with gastrointestinal symptoms for quite a few years now. In the period of 2008-2011 we analysed 22,484 stool samples for D. fragilis. The overall prevalence of the parasite in these samples was 43% but depended mainly on age (Figure 1). D. fragilis prevalence appears to fluctuate dramatically depending on the age group. Highest prevalence was seen among 7-year-olds, and a second 'peak' is seen in the parental age suggesting that infected children pass on infections to their parents. 



Figure 1:  Prevalence of D. fragilis as a function of age. (For more information, see Röser et al., 2013b).

Intestinal protozoa are transmitted faecal-orally and most of them have a cyst stage. However, a few protozoa appear not to have a cyst stage, among them D. fragilis. There is a lot of evidence that Histomonas meleagridis is transmitted by eggs of Heterakis gallinae, a nematode of galliform birds. Conspicuously, we recently demonstrated the presence of D. fragilis DNA in surface-sterilised eggs of Enterobius vermicularis (pinworm). The implications of this finding are unclear but could suggest a similar vector-borne transmission of D. fragilis.

As in so many other situations it is not possible to dish out simple guidelines as to when to test for and treat D. fragilis. It is clear that many carriers experience few or no symptoms at all, but there are several case reports demonstrating symptom relief in patients eradicated of D. fragilis. We published one such case recently in 'Ugeskrift for Læger' - the journal of the Danish Medical Association. Basically, the report describes lasting symptom relief after documented eradication of D. fragilis using high dose metronidazole. However, the patient's symptoms returned after a year, and  real-time PCR revealed D. fragilis positive stools. Eradication was achieved using paromomycin (250 mg x 3 for nine days).

Contrary to Blastocystis, this parasite exhibits remarkably limited genetic diversity. We recently analysed three different genetic loci (18S, actin, elongation factor 1-alpha), and we confirmed that only 2 genotypes exist, one of which is very rare. Genetically, however, the two genotypes are quite different, and it will be interesting to compare the nuclear genomes of the two, once they have become available.

Dientamoeba has been speculated to be a neglected cause/differential diagnosis of irritable bowel syndrome (IBS). We once found a statistical significant association between IBS and Dientamoeba; however, other more recent and more targeted studies (one of which is ongoing) have not confirmed this association. However, multiple factors could interact and analysing only simple associations such as symptoms related to parasite presence/absence may be a limiting approach; for instance, infection load/intensity may play a role, and other factors such as host genetics/susceptibility and microbiota ecology may be significant factors influencing on clinical outcome as well. On that note, we have observed some very low Ct values in our real-time PCR results for some of our D. fragilis positive patients, suggesting massive infections. D. fragilis infections are probably often long lasting (months), and if symptoms appear in the initial phase of infection only, cross-sectional studies of prevalence and clinical presentation will be potentially misleading. Large longitudinal cohort studies of pre-school children with monitoring of incidence of pinworm and D. fragilis infections would be extremely informative.

Dr Dennis Röser here at the SSI is currently finishing a randomised controlled treatment trial of D. fragilis in children, testing the clinical efficacy of metronidazole treatment versus placebo. Results are expected next year, so watch out for a 'D. fragilis special' by Dr Röser in 2014! It appears a lot easier to eradicate D. fragilis than Blastocystis - at least on a short term basis with metronidazole having an efficacy of about 70% or so (unconfirmed).

A couple of reviews free for download are available; please see literature list below or go here and here.

Suggested literature

Engsbro AL, Stensvold CR, Nielsen HV, & Bytzer P (2012). Treatment of Dientamoeba fragilis in patients with irritable bowel syndrome. The American Journal of Tropical Medicine and Hygiene, 87 (6), 1046-52 PMID: 23091195   

Johnson EH, Windsor JJ, & Clark CG (2004). Emerging from obscurity: biological, clinical, and diagnostic aspects of Dientamoeba fragilis. Clinical Microbiology Reviews, 17 (3) PMID: 15258093

Ogren J, Dienus O, Löfgren S, Iveroth P, & Matussek A (2013). Dientamoeba fragilis DNA detection in Enterobius vermicularis eggs. Pathogens and Disease PMID: 23893951  

Röser D, Nejsum P, Carlsgart AJ, Nielsen HV, & Stensvold CR (2013a). DNA of Dientamoeba fragilis detected within surface-sterilized eggs of Enterobius vermicularis. Experimental Parasitology, 133 (1), 57-61 PMID: 23116599   

Röser D, Simonsen J, Nielsen HV, Stensvold CR, & Mølbak K (2013b). Dientamoeba fragilis in Denmark: epidemiological experience derived from four years of routine real-time PCR. European Journal of Clinical Microbiology & Infectious Diseases : official publication of the European Society of Clinical Microbiology, 32 (10), 1303-10 PMID: 23609513  

Stark DJ, Beebe N, Marriott D, Ellis JT, & Harkness J (2006). Dientamoebiasis: clinical importance and recent advances. Trends in Parasitology, 22 (2), 92-6 PMID: 16380293  

Stark D, Barratt J, Roberts T, Marriott D, Harkness J, & Ellis J (2010). A review of the clinical presentation of dientamoebiasis. The American Journal of Tropical Medicine and Hygiene, 82 (4), 614-9 PMID: 20348509

Stensvold CR, Clark CG, & Röser D (2013). Limited intra-genetic diversity in Dientamoeba fragilis housekeeping genes. Infection, Genetics and Evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 18, 284-6 PMID: 23681023

Stensvold CR, Lewis HC, Hammerum AM, Porsbo LJ, Nielsen SS, Olsen KE, Arendrup MC, Nielsen HV, & Mølbak K (2009). Blastocystis: unravelling potential risk factors and clinical significance of a common but neglected parasite. Epidemiology and infection, 137 (11), 1655-63 PMID: 19393117