Showing posts with label Blastocystis Sequence Typing Home Page. Show all posts
Showing posts with label Blastocystis Sequence Typing Home Page. Show all posts

Sunday, May 20, 2012

Brave New World

Using Blastocystis as an example, we have only recently realised the fact that conventional diagnostic methods in many cases fail to detect Blastocystis in faecal samples, which is why we have started using molecular diagnostics for Blastocystis. I was also surprised to realise that apparently no single drug can be used to treat Blastocystis, and that in fact we do not know which combo of drugs will actually consistently eradicate Blastocystis (Stensvold et al., 2010).

There will come a time - and it will be soon - where it will be common to use data from genome sequencing of pathogenic micro-organisms to identify unique signatures suitable for molecular diagnostic assays and to predict suitable targets (proteins) for chemotherapeutic intervention; in fact this is already happening (Hung et al., in press). However, despite already harvesting the fruits of recent technological advances, we will have to bear in mind that the genetic diversity seen within groups of micro-organisms infecting humans may be quite extensive. This of course will hugely impact our ablility to detect these organisms by nucleic acid-based techniques. For many of the micro-eukaryotic organisms which are common parasites of our guts, we still have only very little data available. For Blastocystis, data is building up in GenBank and at the Blastocystis Sequence Typing Databases, but for other parasites such as e.g. some Entamoeba species, Endolimax and Iodamoeba, we have very little data available. We only recently managed to sequence the small subunit ribosomal RNA gene of Iodamoeba, and we demonstrated tremendous genetic variation within the genus; it is now clear that Iodamoeba in humans comprises a species complex rather than "just" Iodamoeba b├╝tschlii (Stensvold et al, 2012).

Cysts of Iodamoeba
Ribosomal RNA is present in all living cells and is the RNA component of the ribosome. We often use this gene for infering phylogenetic relationships, i.e. explaining how closely or distantly related one organism is to another. This again assists us in hypothesising on transmission patterns, pathogenicity, evolution, drug susceptibility and other things. Since ribosomal RNA gene data are available for most known parasites, we often base our molecular diagnostics on such data. However, the specificity and sensitivity of our molecular diagnostic assays such as real-time PCRs are of course always limited by the data available at a given point in time (Stensvold et al., 2011). Therefore substantial sampling from many parts of the world is warranted in order to increase the amount of data available for analysis. In terms of intestinal micro-eukaryotes, we have only seen the beginning. It's great to know data are currently builiding up for Blastocystis from many parts of the world, - recently also from South America (Malheiros et al., 2012) - but the genetic diversity and host specificity of many micro-eukaryotes are still to be explored. It may be somewhat tricky to obtain information, since conventional PCR and sequencing offer significant challenges in terms of obtaining sequence data; such challenges can potentially be solved by metagnomic approaches - today's high throughput take on cloning; however, although the current next generation sequencing technology hype makes us feel that we are almost there, it seems we still have a long way to go - extensive sampling is key!

Cited literature:

Hung, G., Nagamine, K., Li, B., & Lo, S. (2012). Identification of DNA Signatures Suitable for Developing into Real-Time PCR assays by Whole Genome Sequence Approaches: Using Streptococcus pyogenes as a pilot study Journal of Clinical Microbiology DOI: 10.1128/JCM.01155-12

Malheiros AF, Stensvold CR, Clark CG, Braga GB, & Shaw JJ (2011). Short report: Molecular characterization of Blastocystis obtained from members of the indigenous Tapirap├ę ethnic group from the Brazilian Amazon region, Brazil. The American journal of tropical medicine and hygiene, 85 (6), 1050-3 PMID: 22144442

Stensvold, C., Lebbad, M., & Clark, C. (2011). Last of the Human Protists: The Phylogeny and Genetic Diversity of Iodamoeba Molecular Biology and Evolution, 29 (1), 39-42 DOI: 10.1093/molbev/msr238  

Stensvold, C., Lebbad, M., & Verweij, J. (2011). The impact of genetic diversity in protozoa on molecular diagnostics Trends in Parasitology, 27 (2), 53-58 DOI: 10.1016/j.pt.2010.11.005

Stensvold, C., Smith, H., Nagel, R., Olsen, K., & Traub, R. (2010). Eradication of Blastocystis Carriage With Antimicrobials: Reality or Delusion? Journal of Clinical Gastroenterology, 44 (2), 85-90 DOI: 10.1097/MCG.0b013e3181bb86ba

Wednesday, May 2, 2012

Blastocystis Sequence Typing Home Page

Last year, we launched the Blastocystis Sequence Typing Home Page, which is a publicly accessible resource including two major facilities: 1) A sequence database and 2) An isolate database.
The databases cover both SSU-rDNA data and Multilocus Sequence Typing (MLST) data. For those interested in MLST, please visit this paper.The rest of this post will be about SSU-rDNA sequences.

The database has a BLAST function. Barcoding sequences (i.e. sequences which include the 500 5'-most bases in the SSU-rDNA) can be submitted individually or in bulks, and the output file will include information on subtype (ST) and allele. The number of alleles in ST3 is huge (currently n=38) compared to other subtypes, for which only 2-3 alleles have been identified (e.g. ST8). In case a sequence is submitted that is not similar to an allele already present in the database, I suggest that you do an individual sequence query, which enables the generation of an alignment, which will show you the polymorphism(s). In case a new allele is identified, I suggest that we submit this new allele to the sequence database.
We not only strongly encourage using this BLAST feature for quick and standardised subtype and allele identification, but also for submitting isolate data, i.e. barcode sequences with provenance data (data on host, symptoms, geographical origin, etc.); again this can be done by contacting the curator (me); please look up the site for more information.

Our goal is to produce a database which accommodates large sets of data that can be submitted to scrutiny by everyone. The isolate database currently holds almost 700 isolates with 118 unique alleles - I hope this can be expanded much, much more. Also, data extracts can be done at all times, and below is a random example of an extract from human and non-human data from France downloaded from GenBank:
The colours indicate different alleles in different hosts (see legend to the right). A file with all alleles in fasta format is available here. You can paste them into the search field here for a total list of alleles currently in the database; try clicking on a couple to familiarise yourself with the system... One of the things that we can see here is that alleles 34, 36, 37 (ST3) and allele 4 (ST1) are the most common alleles in humans in France. It may seem a bit confusing to speak of both subtypes AND alleles. However, alleles are a good proxy for MLST data, and hence, looking at alleles is useful, e.g. in terms of transmission studies.

There are many other ways of extracting and visualising data from the isolate database. For more information on barcoding, subtypes, alleles, and the databases, please do not hesitate to contact me. I emphasise that the database only works with sequences that include the barcode region; mutliple SSU-rDNA targets have been used for subtyping, but due to the fact that this database is based on barcode data, we recommend that subtyping be done by barcoding (see references).

Useful literature:

Stensvold, C., Alfellani, M., & Clark, C. (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes Infection, Genetics and Evolution, 12 (2), 263-273 DOI: 10.1016/j.meegid.2011.11.002  

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158

Sunday, April 1, 2012

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:
AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA
Exactly! Subtype 1, allele 4!