Tuesday, April 3, 2012

Blastocystis Subtyping - Easy Peasy!

If you are a student or young scientist interested in intestinal parasites and/or infectious disease/molecular epidemiology, why not take to Blastocystis subtyping? It's easy, quick, cheap, and you are guaranteed results. You don't have to sit around and wait for positive samples.
And, best of all: Your data will make a difference!

Once you have your "barcode" sequence(s), you just paste them into the box as described below in the post "Is Blastocystis Zoonotic?", and you will get subtype and allele data right there, without having to consult other resources. However, we recommend that you familiarise yourself with essential papers such as 

Noel et al. (2005)
Scicluna et al. (2006)
Stensvold et al. (2007)

So, how do you get your sequences? Well, you can use DNAs extracted directly from faecal samples (faecal DNAs) or from cultures (I will soon post a note on Blastocystis culture). Multiple PCRs have been described for genetic characterisation of Blastocystis, and most of them target the small subunit (SSU) rRNA gene (18S).

For a variety of reasons (which we are currently listing in an upcoming review - watch out for it!), we recommend using the barcoding approach launched by Scicluna et al. (2006). The RD5 primer combined with BhRDr amplifies a region of approximately ~600 bp, which is usually sufficient to distinguish between subtypes.

Substantial sampling has been done in Europe, while data from Sub-Saharan Africa and the Americas are scarce. Sampling from animals is also highly warranted, especially from rodents, since this group appears to constitute a potential reservoir for human ST4.

In your search for subtypes, it is not unlikely that you will stumble upon what appears to be a new subtype, especially if you are analysing samples from animals. In that case, we recommened that you sequence the entire SSU rRNA gene. Using faecal DNA, this can be challenging (but possible!), so if you have the isolate in culture, then DNA should be extracted from the isolate and used instead to save money and effort. We are about to come up with some thoughts on how to determine whether a sequence represents a new subtype. Stay tuned!

Sunday, April 1, 2012

Scientific Output From My Blastocystis Research

My Blastocystis-related publications can be viewed here:
sciseekclaimtoken-4f7b17c9121c3

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:
AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA
Exactly! Subtype 1, allele 4!

Saturday, March 31, 2012

Blastocystis Treatment

In my opinion, in many cases we should "leave Blastocystis alone". In some cases, however, treatment may be warranted. However, currently there are no convincing drug regimens. RCTs needed.
For more information, please consult this review. 

European Congress on Tropical Medicine and International Health in CPH 2013

Don't forget the VIII’th ECTMIH in Copenhagen September 10-13, 2013, - click here to get flyer.

Why not speculate on our possibilities to host a symposium/work shop on Blastocystis? Potential topics:

1) Blastocystis in the "omics" era - possibilities and perspectives
2) Recent advances in Blastocystis research
3) Standardisation in Blastocystis epidemiological research methodologies

We have been colonised!

Time to revisit: Why it is a bugs life by Jörg Blech (The Guardian (2002)). Speaking of numbers, - I wonder which one is the most successful eukaryote in terms of numbers? Blasto?

Some updates on Blastocystis

Blastocystis is a micro-eukaryote, a so-called protist, parasitising the intestine of humans and a variety of animals.

We estimate that at least 1 billion people worldwide are colonised by this parasite, and we believe that the majority experience no more episodes of intestinal upset, e.g. diarrhoea, than the average individual.

Blastocystis colonises the intestine for a long time (probably months or years).

Many species of Blastocystis are known, of which at least 9 have been found in humans. Such species are currently termed "subtypes" (STs). ST1, ST2, ST3 and ST4 are common in Europe. While ST1, ST2, and ST3 appear to have equal prevalences in patients with diarrhoea and healthy individuals, ST4 appears to be linked to diarrhoea and/or chronic conditions such as irritable bowel syndrome (IBS).

There is no known efficient treatment of Blastocystis. Although metronidazole is often prescribed for Blastocystis infections, there is conflicting reports on its efficacy. Even in combination with a luminal agent, such as paromomycin, Blastocystis eradication cannot be guaranteed.

Whether Blastocystis causes symptoms in humans may depend on factors such as co-evolution. ST3 is the most common subtype in humans and ST3 may account for 30-50% of Blastocystis in humans. ST3 shows substantial intra-subtype genetic variation, and we believe that Blastocystis ST3 has co-evolved with humans, and therefore we may have adapted to ST3 colonisation. ST4 on the other hand is almost clonal and may have entered the human population relatively recently. This could partly explain why ST4 colonisation has been linked to intestinal symptoms.

Further reading:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. ST4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea.

Friday, March 30, 2012

XXVIII SBPz Meeting in Caxambu, Brazil in October - key note on Blastocystis

Looking forward to giving key note talk at XXVIII SBPz (SociedadeBrasileira de Protozoologia) in Caxambu - Minas Gerais - Brazil in October. Title of talk: Blastocystis - friend or foe?

Blastocystis - An Opportunistic Pathogen?

Browsed the paper by Chandramathi et al. (2012) on Infections of Blastocystis hominis and microsporidia in cancer patients: are they opportunistic? I'm surprised about the low prevalence incidence of Blastocystis... I'm also suprised that the authors do not mention potential disturbance of the gut flora by antineoplastic drugs that could influence colonisation of Blastocystis.

Thursday, March 29, 2012

Blastocystis makes it to PLoS Pathogens!

Whether "New Insights" or not: Blastocystis makes it to PLoS Pathogens! Congratulations to our colleagues!

New Insights into Blastocystis spp.: A Potential Link with Irritable Bowel Syndrome

Blastocystis Sequence Type Home Page - use it!

For all of you interested in subtyping of Blastocystis:

We recommend using barcoding (look up the paper by Scicluna et al., 2012 for primer sequences and gene target). Sequences can easily be assigned to subtype and even allele by using the blast alogorithm at

The Blastocystis Sequence Type Home Page

Batch submission of sequences even possible... should enable some speedy results!

Another Risk Factor Study

Absence of a piped water supply and low levels of mothers' education were the significant predictors of Blastocystis infection in a recent study of school children in Lipis and Raub districts of Pahang state, Malaysia (Abdulsalam et al., 2012)


Drinking water is a significant predictor of Blastocystis infection among rural Malaysian primary schoolchildren.

The study shows the clear benefit of using culture as opposed to e.g. concentration of fresh stools, and reports an overall prevalence of 25.7%. Looking forward to subtype data...

Novel Blastocystis real-time PCR

Our new real-time PCR for Blastocystis has been published in JCM.

Check it out at

Development and evaluation of a genus-specific, probe-based, internal process controlled real-time PCR assay for sensitive and specific detection of Blastocystis.

or

http://www.ncbi.nlm.nih.gov/pubmed/22422846

and use it!