On Blastocystis and Animal Models

I was recently encouraged by one of my readers to do a blog post on Blastocystis and animal experimental models. This is not exactly my core competence, which probably boils down to the fact that animal models have only been scarcely used in Blastocystis research for reasons that I will try to account for below.

Animal models (mice, rats, guinea pigs) have often been used to study interactions between hosts and microbes as well as the effect of chemotherapeutic interventions. Therefore, one might assume that animal models are an obvious way of potentially establishing a link between Blastocystis and pathology. But currently, the rationale for carrying out some types of Blastocystis experiments on, say, mice or rats is limited. Why? Well, first and foremost because of at least three major issues.

1) Lack of correlation between in vitro and in vivo evidence. Experimental infections of laboratory mice (Elwakil and Hewedi, 2010) resulted in tissue invasion - something never reported in humans. Another study showed increased oxidative stress in Blastocystis infected rats (Chandramathi et al., 2010), again something not linked to human colonisation. Studies that provided evidence for induction of cytokines, contact mediated apoptosis, and barrier disruption all used axenic Blastocystis and in vitro mammalian cell cultures with no evidence that these effect occur in vivo.

2) Host specificity. Blastocystis exhibits extreme genetic diversity and multiple, genetically very different variants (species, subtypes) exist. These subtypes exhibit moderate host specificity. This means that some subtypes are common in one type of host, whereas other subtypes are common in other types of hosts. For instance, ST5 is very common in pigs, but we rarely see it in humans. ST4 is common in rodents, and in some human populations (mainly Europe it seems), but otherwise extremely uncommon. And so on. This means that some subtypes may be difficult to establish in experimental animals. It also means that any pathology detected in the animal, may not be “reproducible” in another host, - maybe due to the fact that this host has adapted to this particular subtype or even strain. Blastocystis is common in a huge variety of animals, and different animals may have adapted do different subtypes. It is not unlikely that this is due to co-evolution, and therefore it may not turn out to be a big surprise if Blastocystis per se is not usually directly associated with disease. It may still be so, however, that for humans, some subtypes or strains may be associated with disease, preliminary data point in this direction.

3) Study design. Another issue is the use of appropriate controls – for example, experimental infection of animals with Blastocystis from cultures growing with bacteria need to have the appropriate controls - namely infection with the accompanying bacterial flora alone – before it can be concluded that Blastocystis is responsible for any effects seen. It is extremely difficult to axenise (i.e. make sterile) Blastocystis strains, so they will always be accompanied by some bacterial species. Hence, any effect noticed after challenge with a Blastocystis strain will be difficult to interpret, - is it due to Blastocystis or to accompanying bacterial strains? (If you want to see what Blastocystis look like in culture, go to my previous blog post here.)

So, results from scientific studies using animal experimental models should be interpreted cautiously. In vitro experimental models using enterocyte mono-layers for instance may constitute a more attractive alternative, but the problems of using xenic (i.e. unsterile) strains are evident also here. A great challenge ahead is the development of a standardised method for axenising (sterilising) strains… so far, such a method does not exist.

Our French colleagues recently published the genome of Blastocystis sp. ST7. Functional genomic analysis is key to understanding the extent to which Blastocystis is capable of exerting any direct pathological effect, and will assist us in studying the potential pathogenicity of Blastocystis in the absence of a suitable animal model. Indirect pathological effects may be more difficult to identify and probably require studies of the interaction between the host, the parasite and the rest of the gut microbiota (bacteria). Given our recent technological advances, I believe that a pathway to knowledge lies in the study of Blastocystis in an ecological context. I think that we should get an understanding of: 1) Who are colonized with Blastocystis, 2) From where do we get it, 3) For how long do we have the parasite, and do we establish symptoms in the very beginning, only to adapt to the presence of the parasite later on, 4) does Blastocystis require a particular flora to establish (and are there differences between subtypes (in humans and animals)), 5) could Blastocystis be seen as a proxy for a given gut microbiota (biomarker), and/or does Blastocystis select for a given microbiota phenotype (metatranscriptomic analysis of the intestinal flora accompanying Blastocystis might be useful to study how the bacteria “behave” (i.e. gene expression) in the presence/absence of Blastocystis), 6) are any Blastocystis-induced symptoms related to parasite abundance, etc.; this can be explored in rough detail by using real-time PCR, of which two have been published.

So, while animal models may not be immediately suitable in our quest to study Blastocystis pathogenicity, our “omics” methodologies and data analyses may sooner than we know help us answer many of the questions that we have been pondering for decades.

Having said that, I think that for instance a pig experimental model might be useful in terms of studying the effect of chemotherapeutic intervention. Obvious studies include those aiming to identify drugs capable of eradicating Blastocystis, but it could also be interesting to study the structure and function (gene expression profiling) of the accompanying microbiota before and after intervention.
Since pig feed often contains a range of antibiotics, it could be interesting to test whether pigs on diets +/- antibiotics differ in terms of Blastocystis colonisation... a recent PNAS paper demonstrates a shift in the structure and function of the microbiome in medicated pigs compared to pigs fed a diet void of antibiotics.

Further reading:

Chandramathi S, Suresh KG, Mahmood AA, & Kuppusamy UR (2010). Urinary hyaluronidase activity in rats infected with Blastocystis hominis--evidence for invasion? Parasitology research, 106 (6), 1459-63 PMID: 20358228

Elwakil HS, & Hewedi IH (2010). Pathogenic potential of Blastocystis hominis in laboratory mice. Parasitology research, 107 (3), 685-9 PMID: 20499092

Hussein EM, Hussein AM, Eida MM, & Atwa MM (2008). Pathophysiological variability of different genotypes of human Blastocystis hominis Egyptian isolates in experimentally infected rats. Parasitology research, 102 (5), 853-60 PMID: 18193282 

Iguchi A, Ebisu A, Nagata S, Saitou Y, Yoshikawa H, Iwatani S, & Kimata I (2007). Infectivity of different genotypes of human Blastocystis hominis isolates in chickens and rats. Parasitology international, 56 (2), 107-12 PMID: 17251054

Looft T, Johnson TA, Allen HK, Bayles DO, Alt DP, Stedtfeld RD, Sul WJ, Stedtfeld TM, Chai B, Cole JR, Hashsham SA, Tiedje JM, & Stanton TB (2012). In-feed antibiotic effects on the swine intestinal microbiome. Proceedings of the National Academy of Sciences of the United States of America, 109 (5), 1691-6 PMID: 22307632

Scanlan PD (2012). Blastocystis: past pitfalls and future perspectives. Trends in parasitology PMID: 22738855

Stensvold CR, Alfellani MA, Nørskov-Lauritsen S, Prip K, Victory EL, Maddox C, Nielsen HV, & Clark CG (2009). Subtype distribution of Blastocystis isolates from synanthropic and zoo animals and identification of a new subtype. International journal for parasitology, 39 (4), 473-9 PMID: 18755193

Stensvold CR (2012). Thinking Blastocystis out of the box. Trends in parasitology PMID: 22704911

Yan Y, Su S, Ye J, Lai X, Lai R, Liao H, Chen G, Zhang R, Hou Z, & Luo X (2007). Blastocystis sp. subtype 5: a possibly zoonotic genotype. Parasitology research, 101 (6), 1527-32 PMID: 17665214

Blastocystis: To Treat or Not to Treat...

This year, Coyle et al. published a Clinical Practice paper in Clinical Infectious Diseases, a journal with a 5-year impact factor of almost 8. It is still difficult to get papers on Blastocystis published in clinical, peer-reviewed journals of major impact, probably due to the fact that evidence of Blastocystis' pathogenicity is so far only indicative, so it is great to see that the authors have managed to get their manuscript past those iron doors!

A few issues have come to my attention. When reading the abstract the reader will get the impression that subtypes are synonymous with genotypes, which is not the case. In the case of Blastocystis, a subtype is equivalent to a species; one of the reasons why we haven't allocated species names to Blastocystis from humans, other mammals and birds yet, is that we do not have sufficient data on genetic diversity and host specificity to come up with relevant names.

It says in the first page (pdf) that Blastocystis subtype (ST) 3 is found only in humans, which is not true. This subtype is common in non-human primates and can be seen in other, larger animals, including dogs, and also birds, if I remember correctly. However, so far, we only have multilocus sequence typing data from human and non-human primates, and these data indicate that ST3 found in non-human primates is often different from ST3 found in humans.

The authors recommend that asymptomatic individuals with few cysts should not be treated. Then what about asymptomatic individuals with many cysts? Also, with the diagnostic short-comings of microscopy of faecal concentrates, the suggested cut-off at 5 organisms per visual field appears arbitrary and, in best case, fortuitous.

In the abstract, the authors state that metronidazole is the drug of choice, although they appear to be quite aware that this drug has limited effect in terms of eradicating Blastocystis. So, why is metronidazole the drug of choice? Blastocystis is a parasite lodged primarily in the large intestine, and therefore we must anticipate that metronidazole often fails to reach the the parasite in sufficient concentrations due to absorption proximally in the gut. Luminal agents, such as paromomycin, are probably more likely to work, maybe in combination with metronidazole, although we have had a case, where even this combination was not effective.

When reviewing studies of treatment, it is important to acknowledge that insensitive methods have been used to evaluate drug efficacy. Culture combined with PCR is in my opinion the best method available in this respect. I prefer adding culture to the test, since culture detects viable Blastocystis (as opposed to PCR which will detect both viable and non-viable cells). Future randomised controlled treatment studies should therefore use culture and PCR to identify carriers both pre- and post-treatment. Whether Blastocystis-positive stool post-treatment is due to recrudescence, resistance or reinfection is not easily evaluated, but some useful information can be achieved by multi-locus sequence typing of isolates pre- and post-treatment.

Literature cited:

Coyle CM, Varughese J, Weiss LM, & Tanowitz HB (2012). Blastocystis: to treat or not to treat... Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 54 (1), 105-10 PMID: 22075794  

Stensvold CR, Alfellani M, & Clark CG (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 12 (2), 263-73 PMID: 22116021  

Stensvold CR, Smith HV, Nagel R, Olsen KE, & Traub RJ (2010). Eradication of Blastocystis carriage with antimicrobials: reality or delusion? Journal of clinical gastroenterology, 44 (2), 85-90 PMID: 19834337

Blastocystis Sequence Typing Home Page

Last year, we launched the Blastocystis Sequence Typing Home Page, which is a publicly accessible resource including two major facilities: 1) A sequence database and 2) An isolate database.
The databases cover both SSU-rDNA data and Multilocus Sequence Typing (MLST) data. For those interested in MLST, please visit this paper.The rest of this post will be about SSU-rDNA sequences.

The database has a BLAST function. Barcoding sequences (i.e. sequences which include the 500 5'-most bases in the SSU-rDNA) can be submitted individually or in bulks, and the output file will include information on subtype (ST) and allele. The number of alleles in ST3 is huge (currently n=38) compared to other subtypes, for which only 2-3 alleles have been identified (e.g. ST8). In case a sequence is submitted that is not similar to an allele already present in the database, I suggest that you do an individual sequence query, which enables the generation of an alignment, which will show you the polymorphism(s). In case a new allele is identified, I suggest that we submit this new allele to the sequence database.
We not only strongly encourage using this BLAST feature for quick and standardised subtype and allele identification, but also for submitting isolate data, i.e. barcode sequences with provenance data (data on host, symptoms, geographical origin, etc.); again this can be done by contacting the curator (me); please look up the site for more information.

Our goal is to produce a database which accommodates large sets of data that can be submitted to scrutiny by everyone. The isolate database currently holds almost 700 isolates with 118 unique alleles - I hope this can be expanded much, much more. Also, data extracts can be done at all times, and below is a random example of an extract from human and non-human data from France downloaded from GenBank:

The colours indicate different alleles in different hosts (see legend to the right). A file with all alleles in fasta format is available here. You can paste them into the search field here for a total list of alleles currently in the database; try clicking on a couple to familiarise yourself with the system... One of the things that we can see here is that alleles 34, 36, 37 (ST3) and allele 4 (ST1) are the most common alleles in humans in France. It may seem a bit confusing to speak of both subtypes AND alleles. However, alleles are a good proxy for MLST data, and hence, looking at alleles is useful, e.g. in terms of transmission studies.

There are many other ways of extracting and visualising data from the isolate database. For more information on barcoding, subtypes, alleles, and the databases, please do not hesitate to contact me. I emphasise that the database only works with sequences that include the barcode region; mutliple SSU-rDNA targets have been used for subtyping, but due to the fact that this database is based on barcode data, we recommend that subtyping be done by barcoding (see references).

Useful literature:

Stensvold, C., Alfellani, M., & Clark, C. (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes Infection, Genetics and Evolution, 12 (2), 263-273 DOI: 10.1016/j.meegid.2011.11.002  

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158

Blastocystis Facts Sheet

I've tried to summarise a few facts here:

• Blastocystis is a single-celled, microbial parasitic protist colonising mainly the large intestine of man and other mammals, birds, reptiles, and other animals, even insects.
• The parasite is extremely common in humans, and possibly the most common microbial non-fungal eukaryote in the human intestine. More than one billion people may be colonised.
• Blastocystis comprises many ribosomal lineages, most or all of which are comparable to separate species; they are currently known as subtypes (ST).
• Humans are common hosts of ST1, ST2, ST3 and ST4, whereas other subtypes such as ST6, ST7 and ST8 are seen occasionally. ST5 and ST9 are very rare in humans. 
• Almost all subtypes found in humans are also found in animals; however, zoonotic transmission is probably uncommon, at least for the most common subtypes (ST1—ST4).
• Most carriers do probably not experience more intestinal symptoms than the average individual.
• We do not know when to seek to eradicate Blastocystis and there are no valid treatment guidelines. The effect of metronidazole may be very limited.
•  ST3 is probably the most common subtype in humans.
• ST4 may be more much more common in Europe than outside Europe. 
• ST4 has been seen frequently in patients with different types of diarrhoea or other intestinal problems, but appears uncommon in healthy individuals.
• Blastocystis is best detected by (real-time) PCR and culture; conventional parasitological techniques have generally poor sensitivity.

·         Ongoing epidemiological studies seek to analyse subtype distributions in various cohorts, e.g. IBS patients and the background population. We also continuously explore the genetic variation and host specificity of Blastocystis. Genome studies seek to unravel virulence genes that may be involved in pathogenesis, but only the genome for ST7 has been sequenced so far.

Blastocystis Subtyping in Routine Microbiology Labs

When I speak to colleagues in and outside Europe and visit research portals and social media, including Facebook groups, I get the impression that Blastocystis subtyping is something that is still very rarely done, despite the fact that most clinical microbiologists and biologists acknowledge that subtypes may differ in terms of clinical significance and in other respects. We get new data on Blastocystis subtypes in various cohorts from time to time from research groups around the world, but all reports are characterised by relatively small sample sizes and subtyping methodology has not yet been standardised. This type of research is moreover challenged by the fact that Blastocystis is common in healthy individuals (i.e. people not seeing their GPs for gastrointestinal problems), and this makes it extremely difficult to identify the subtype distribution in the "background" population.

Although we recommend barcoding (see one of my previous posts) as the subtyping method of choice, there is no "official report" identifying the Blastocystis subtyping gold standard. Therefore, I'm currently setting up a lab project that is going to help us compare the most common methods used for subtyping in order to identify the one most suitable. I emphasise that the best method used for subtyping is not the PCR that should be used for diagnostic purposes, mostly due to the fact that PCRs for subtyping amplify 300-600 bp, which are much longer amplicons than the one we go for in diagnostic PCRs (typically 80-100 bp). We therefore recommend our novel TaqMan-based real-time PCR for initial diagnosis, or culture, which is inexpensive and relatively easy and provides you with a good source of cells for DNA extraction.
I hope that we will be able to come up with some robust data soon that will allow us to recommend the most suitable approach and hope to publish our results in a clinical microbiology journal of high impact, and I hope that this will prompt Blastocystis subtyping in many labs. Once this report has been published, I intend to upload a protocol here at the site where lab procedures for diagnosis and subtyping will be described in detail. Stay tuned!

On Subtypes, Genotypes, Alleles and Sequence Types (SQTs)

There has been some confusion about Blastocystis "subtypes" and "genotypes". 

Often, these two terms have been used interchangeably. While “subtype” refers to a distinct ribosomal lineage (which in the case of Blastocystis may very well be a distinct species), “genotype” denotes variation WITHIN subtypes. 

Currently, there is no clear definition of genotypes in Blastocystis. Based on phylogenetic analysis of barcode sequences of ST4, the existence of two genotypes in ST4 has been mentioned (Stensvold et al., 2011).  

Based on markers in the mitochondrion-like organelle of Blastocystis, we recently developed MLST assays for ST3 and ST4 and published data on intra-subtype variation in these two subtypes (Stensvold et al., 2012). While 58 sequence types (SQTs) were found among 81 ST3 isolates, only 5 SQTs were found among 50 ST4 isolates. 

By comparing SQTs with barcode sequences, we discovered that barcode sequences belonging to the same subtype may display intra-subtype diversity, and we found out that barcode sequences can be seen as valid proxies for SQTs. We have chosen to use the term "allele" to enable denotation of variation in barcode sequences. Currently, we have discovered 38 ST3 alleles (i.e. 38 different ST3 barcode sequences) as opposed to 8 different ST4 alleles. There are still no published data on ST1 and ST2 SQTs, but given the fact that 22 different alleles have been discovered so far for each of these two subtypes, we may expect a substantial number of SQTs.

The world of Blastocystis terminology and subtyping, etc. may seem a bit overwhelming and at times confusing, but believe me, - much has improved since 2006, when Blastocystis terminology was completely up in the air! 

For more information or further clarification, please don't hesitate to contact me.

Cited literature:

1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol. 2012 Mar; 12 (2) :263-73. PubMed PMID:22116021.

2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. subtype 4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea. Am J Trop Med Hyg. 2011 Jun; 84 (6) :883-5. PubMed PMID:21633023; PubMed Central PMCID: PMC3110361.

A Few Words On Blastocystis Morphology and Diagnosis

Blastocystis is a sinlge-celled parasite. The parasite produces cysts (probably the transmissible form) and vegetative stages (including the stage commonly referred to as the vacuolar stage). Vegetative stages are commonly seen in fresh faecal samples and in culture. This is what they look like under light microscopy:

Vegetative stages of Blastocystis (unstained) (source: www.dpd.cdc.gov)

Using permanent staining of fixed faecal material, the eccentrically located nuclei become more apparent:

Vegegtative stages of Blastocystis (Trichrome stain) (source: www.dpd.cdc.gov)

Although sensitive, permanent staining techniques (e.g. Trichrome, Giemsa and Iron Haematoxylin) are relatively time-consuming, impractical and expensive. Since also conventional concentration of unfixed stool using e.g. the Formol Ethyl-Acetate Concentration Technique is not appropriate for diagnosis (Blastocystis cysts are very difficult to pick up, and vacuolar stages become distorted or disintegrate), we recommend short-term in-vitro culture (using Jones' or Robinson's medium) and/or Real-Time-PCR on genomic DNAs extracted directly from faeces using QIAGEN Stool Mini Kit (QIAGEN, Hilden, Germany) or - in modern laboratories - by automated DNA extraction robots. Once genomic DNAs have been extracted and screened by PCR, positive samples can be submitted to subtyping using the barcoding method, and DNAs can be screened for other parasites by PCR as well. In fact the use of insensitive methods to distinguish carriers from non-carriers is one of our greatest obstacles to obtaining valid prevalence data on Blastocystis.

Having an isolate in culture adds the benefit of having a continuous source of DNA for further genetic characterisation (for instance complete SSU-rDNA sequencing) in case a particular isolate turns out to be genetically different from those already present in GenBank or the isolate database at Blastocystis Sequence Typing Home Page. And chances are that there are quite a few "novel" subtypes out there... especially in animals. However, Blastocystis from animals may not always be successfully established in culture.

Why "Blastocystis sp." and not "Blastocystis hominis"?

Blastocystis identified in humans used to be referred to as "Blastocystis hominis". However, after the advanced use of nucleic acid-based tools in the 90s and 00s it became clear that

1) morphologically identical Blastocystis can be genetically extremely diverse
2) Blastocystis in humans comprises at least 9 species (or, perhaps more correctly, ribosomal lineages), 8 of which can be found in other animals as well.

This means that host origin is not a reliable indicator of organism identity.

Blastocystis appears to exhibit only moderate host specificity - at least at subtype level - , and until a more substantial sampling from various hosts has been carried out, we will have to go with "Blastocystis sp." followed by an appropriate subtype (ST) number (according to species/ribosomal lineage), e.g. "Blastocystis sp. ST3", which is one of the 4 subtypes commonly found in humans.

In order to make subtype analysis very easy, we have created a site (together with Keith Jolley, Oxford University), where a bulk of sequences can be assigned to subtype in few seconds. Single sequence entries are also possible.

To sum up: Blastocystis hominis is a misleading and currently an invalid taxon.

(Read more about this in our Blastocystis consensus paper from 2007 in Trends in Parasitology)

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!

Some updates on Blastocystis

Blastocystis is a micro-eukaryote, a so-called protist, parasitising the intestine of humans and a variety of animals.

We estimate that at least 1 billion people worldwide are colonised by this parasite, and we believe that the majority experience no more episodes of intestinal upset, e.g. diarrhoea, than the average individual.

Blastocystis colonises the intestine for a long time (probably months or years).

Many species of Blastocystis are known, of which at least 9 have been found in humans. Such species are currently termed "subtypes" (STs). ST1, ST2, ST3 and ST4 are common in Europe. While ST1, ST2, and ST3 appear to have equal prevalences in patients with diarrhoea and healthy individuals, ST4 appears to be linked to diarrhoea and/or chronic conditions such as irritable bowel syndrome (IBS).

There is no known efficient treatment of Blastocystis. Although metronidazole is often prescribed for Blastocystis infections, there is conflicting reports on its efficacy. Even in combination with a luminal agent, such as paromomycin, Blastocystis eradication cannot be guaranteed.

Whether Blastocystis causes symptoms in humans may depend on factors such as co-evolution. ST3 is the most common subtype in humans and ST3 may account for 30-50% of Blastocystis in humans. ST3 shows substantial intra-subtype genetic variation, and we believe that Blastocystis ST3 has co-evolved with humans, and therefore we may have adapted to ST3 colonisation. ST4 on the other hand is almost clonal and may have entered the human population relatively recently. This could partly explain why ST4 colonisation has been linked to intestinal symptoms.

Further reading:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. ST4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea.