A Few Words On Blastocystis Morphology and Diagnosis

Blastocystis is a sinlge-celled parasite. The parasite produces cysts (probably the transmissible form) and vegetative stages (including the stage commonly referred to as the vacuolar stage). Vegetative stages are commonly seen in fresh faecal samples and in culture. This is what they look like under light microscopy:

Vegetative stages of Blastocystis (unstained) (source: www.dpd.cdc.gov)

Using permanent staining of fixed faecal material, the eccentrically located nuclei become more apparent:

Vegegtative stages of Blastocystis (Trichrome stain) (source: www.dpd.cdc.gov)

Although sensitive, permanent staining techniques (e.g. Trichrome, Giemsa and Iron Haematoxylin) are relatively time-consuming, impractical and expensive. Since also conventional concentration of unfixed stool using e.g. the Formol Ethyl-Acetate Concentration Technique is not appropriate for diagnosis (Blastocystis cysts are very difficult to pick up, and vacuolar stages become distorted or disintegrate), we recommend short-term in-vitro culture (using Jones' or Robinson's medium) and/or Real-Time-PCR on genomic DNAs extracted directly from faeces using QIAGEN Stool Mini Kit (QIAGEN, Hilden, Germany) or - in modern laboratories - by automated DNA extraction robots. Once genomic DNAs have been extracted and screened by PCR, positive samples can be submitted to subtyping using the barcoding method, and DNAs can be screened for other parasites by PCR as well. In fact the use of insensitive methods to distinguish carriers from non-carriers is one of our greatest obstacles to obtaining valid prevalence data on Blastocystis.

Having an isolate in culture adds the benefit of having a continuous source of DNA for further genetic characterisation (for instance complete SSU-rDNA sequencing) in case a particular isolate turns out to be genetically different from those already present in GenBank or the isolate database at Blastocystis Sequence Typing Home Page. And chances are that there are quite a few "novel" subtypes out there... especially in animals. However, Blastocystis from animals may not always be successfully established in culture.

Why "Blastocystis sp." and not "Blastocystis hominis"?

Blastocystis identified in humans used to be referred to as "Blastocystis hominis". However, after the advanced use of nucleic acid-based tools in the 90s and 00s it became clear that

1) morphologically identical Blastocystis can be genetically extremely diverse
2) Blastocystis in humans comprises at least 9 species (or, perhaps more correctly, ribosomal lineages), 8 of which can be found in other animals as well.

This means that host origin is not a reliable indicator of organism identity.

Blastocystis appears to exhibit only moderate host specificity - at least at subtype level - , and until a more substantial sampling from various hosts has been carried out, we will have to go with "Blastocystis sp." followed by an appropriate subtype (ST) number (according to species/ribosomal lineage), e.g. "Blastocystis sp. ST3", which is one of the 4 subtypes commonly found in humans.

In order to make subtype analysis very easy, we have created a site (together with Keith Jolley, Oxford University), where a bulk of sequences can be assigned to subtype in few seconds. Single sequence entries are also possible.

To sum up: Blastocystis hominis is a misleading and currently an invalid taxon.

(Read more about this in our Blastocystis consensus paper from 2007 in Trends in Parasitology)

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!

Some updates on Blastocystis

Blastocystis is a micro-eukaryote, a so-called protist, parasitising the intestine of humans and a variety of animals.

We estimate that at least 1 billion people worldwide are colonised by this parasite, and we believe that the majority experience no more episodes of intestinal upset, e.g. diarrhoea, than the average individual.

Blastocystis colonises the intestine for a long time (probably months or years).

Many species of Blastocystis are known, of which at least 9 have been found in humans. Such species are currently termed "subtypes" (STs). ST1, ST2, ST3 and ST4 are common in Europe. While ST1, ST2, and ST3 appear to have equal prevalences in patients with diarrhoea and healthy individuals, ST4 appears to be linked to diarrhoea and/or chronic conditions such as irritable bowel syndrome (IBS).

There is no known efficient treatment of Blastocystis. Although metronidazole is often prescribed for Blastocystis infections, there is conflicting reports on its efficacy. Even in combination with a luminal agent, such as paromomycin, Blastocystis eradication cannot be guaranteed.

Whether Blastocystis causes symptoms in humans may depend on factors such as co-evolution. ST3 is the most common subtype in humans and ST3 may account for 30-50% of Blastocystis in humans. ST3 shows substantial intra-subtype genetic variation, and we believe that Blastocystis ST3 has co-evolved with humans, and therefore we may have adapted to ST3 colonisation. ST4 on the other hand is almost clonal and may have entered the human population relatively recently. This could partly explain why ST4 colonisation has been linked to intestinal symptoms.

Further reading:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. ST4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea.