On Subtypes, Genotypes, Alleles and Sequence Types (SQTs)

There has been some confusion about Blastocystis "subtypes" and "genotypes". 

Often, these two terms have been used interchangeably. While “subtype” refers to a distinct ribosomal lineage (which in the case of Blastocystis may very well be a distinct species), “genotype” denotes variation WITHIN subtypes. 

Currently, there is no clear definition of genotypes in Blastocystis. Based on phylogenetic analysis of barcode sequences of ST4, the existence of two genotypes in ST4 has been mentioned (Stensvold et al., 2011).  

Based on markers in the mitochondrion-like organelle of Blastocystis, we recently developed MLST assays for ST3 and ST4 and published data on intra-subtype variation in these two subtypes (Stensvold et al., 2012). While 58 sequence types (SQTs) were found among 81 ST3 isolates, only 5 SQTs were found among 50 ST4 isolates. 

By comparing SQTs with barcode sequences, we discovered that barcode sequences belonging to the same subtype may display intra-subtype diversity, and we found out that barcode sequences can be seen as valid proxies for SQTs. We have chosen to use the term "allele" to enable denotation of variation in barcode sequences. Currently, we have discovered 38 ST3 alleles (i.e. 38 different ST3 barcode sequences) as opposed to 8 different ST4 alleles. There are still no published data on ST1 and ST2 SQTs, but given the fact that 22 different alleles have been discovered so far for each of these two subtypes, we may expect a substantial number of SQTs.

The world of Blastocystis terminology and subtyping, etc. may seem a bit overwhelming and at times confusing, but believe me, - much has improved since 2006, when Blastocystis terminology was completely up in the air! 

For more information or further clarification, please don't hesitate to contact me.

Cited literature:

1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol. 2012 Mar; 12 (2) :263-73. PubMed PMID:22116021.

2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. subtype 4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea. Am J Trop Med Hyg. 2011 Jun; 84 (6) :883-5. PubMed PMID:21633023; PubMed Central PMCID: PMC3110361.

A Few Words On Blastocystis Morphology and Diagnosis

Blastocystis is a sinlge-celled parasite. The parasite produces cysts (probably the transmissible form) and vegetative stages (including the stage commonly referred to as the vacuolar stage). Vegetative stages are commonly seen in fresh faecal samples and in culture. This is what they look like under light microscopy:

Vegetative stages of Blastocystis (unstained) (source: www.dpd.cdc.gov)

Using permanent staining of fixed faecal material, the eccentrically located nuclei become more apparent:

Vegegtative stages of Blastocystis (Trichrome stain) (source: www.dpd.cdc.gov)

Although sensitive, permanent staining techniques (e.g. Trichrome, Giemsa and Iron Haematoxylin) are relatively time-consuming, impractical and expensive. Since also conventional concentration of unfixed stool using e.g. the Formol Ethyl-Acetate Concentration Technique is not appropriate for diagnosis (Blastocystis cysts are very difficult to pick up, and vacuolar stages become distorted or disintegrate), we recommend short-term in-vitro culture (using Jones' or Robinson's medium) and/or Real-Time-PCR on genomic DNAs extracted directly from faeces using QIAGEN Stool Mini Kit (QIAGEN, Hilden, Germany) or - in modern laboratories - by automated DNA extraction robots. Once genomic DNAs have been extracted and screened by PCR, positive samples can be submitted to subtyping using the barcoding method, and DNAs can be screened for other parasites by PCR as well. In fact the use of insensitive methods to distinguish carriers from non-carriers is one of our greatest obstacles to obtaining valid prevalence data on Blastocystis.

Having an isolate in culture adds the benefit of having a continuous source of DNA for further genetic characterisation (for instance complete SSU-rDNA sequencing) in case a particular isolate turns out to be genetically different from those already present in GenBank or the isolate database at Blastocystis Sequence Typing Home Page. And chances are that there are quite a few "novel" subtypes out there... especially in animals. However, Blastocystis from animals may not always be successfully established in culture.

Why "Blastocystis sp." and not "Blastocystis hominis"?

Blastocystis identified in humans used to be referred to as "Blastocystis hominis". However, after the advanced use of nucleic acid-based tools in the 90s and 00s it became clear that

1) morphologically identical Blastocystis can be genetically extremely diverse
2) Blastocystis in humans comprises at least 9 species (or, perhaps more correctly, ribosomal lineages), 8 of which can be found in other animals as well.

This means that host origin is not a reliable indicator of organism identity.

Blastocystis appears to exhibit only moderate host specificity - at least at subtype level - , and until a more substantial sampling from various hosts has been carried out, we will have to go with "Blastocystis sp." followed by an appropriate subtype (ST) number (according to species/ribosomal lineage), e.g. "Blastocystis sp. ST3", which is one of the 4 subtypes commonly found in humans.

In order to make subtype analysis very easy, we have created a site (together with Keith Jolley, Oxford University), where a bulk of sequences can be assigned to subtype in few seconds. Single sequence entries are also possible.

To sum up: Blastocystis hominis is a misleading and currently an invalid taxon.

(Read more about this in our Blastocystis consensus paper from 2007 in Trends in Parasitology)

Happy Easter!

I’m still exploring the potential of this blog. I’m happy to see that I have a constant flow of visitors. The aim of the blog is to serve primarily as a resource for ”people in business” and for all of those who are colonised with Blastocystis or who take an interest in the parasite for some reason.

As a courtesy to my colleagues, I plan to provide regular updates on Blastocystis research, information on tools that will make your Blastocystis studies easier, SOPs and protocols on lab procedures such as sampling, culture, PCR screening, subtyping, sequence typing (MLST), phylogenetic analysis and identification of (new) subtypes. Occasionally, I will also try to go into more detail with some of the things that I find particularly interesting.

For those not in business but who seek some useful information on Blastocystis I plan to do a short overview with some bullet points in plain language on the clinical and public health significance of Blastocystis, - what to think of it, when to treat, transmission, prevalence, etc. For all, it is important for me to try and provide some impartial information on Blastocystis; there are people out there trying to make a commercial success of Blastocystis, perpetuating anecdotal data and information on the parasite for which there is currently no support. 

Blastocystis Subtyping - Easy Peasy!

If you are a student or young scientist interested in intestinal parasites and/or infectious disease/molecular epidemiology, why not take to Blastocystis subtyping? It's easy, quick, cheap, and you are guaranteed results. You don't have to sit around and wait for positive samples.
And, best of all: Your data will make a difference!

Once you have your "barcode" sequence(s), you just paste them into the box as described below in the post "Is Blastocystis Zoonotic?", and you will get subtype and allele data right there, without having to consult other resources. However, we recommend that you familiarise yourself with essential papers such as 

Noel et al. (2005)
Scicluna et al. (2006)
Stensvold et al. (2007)

So, how do you get your sequences? Well, you can use DNAs extracted directly from faecal samples (faecal DNAs) or from cultures (I will soon post a note on Blastocystis culture). Multiple PCRs have been described for genetic characterisation of Blastocystis, and most of them target the small subunit (SSU) rRNA gene (18S).

For a variety of reasons (which we are currently listing in an upcoming review - watch out for it!), we recommend using the barcoding approach launched by Scicluna et al. (2006). The RD5 primer combined with BhRDr amplifies a region of approximately ~600 bp, which is usually sufficient to distinguish between subtypes.

Substantial sampling has been done in Europe, while data from Sub-Saharan Africa and the Americas are scarce. Sampling from animals is also highly warranted, especially from rodents, since this group appears to constitute a potential reservoir for human ST4.

In your search for subtypes, it is not unlikely that you will stumble upon what appears to be a new subtype, especially if you are analysing samples from animals. In that case, we recommened that you sequence the entire SSU rRNA gene. Using faecal DNA, this can be challenging (but possible!), so if you have the isolate in culture, then DNA should be extracted from the isolate and used instead to save money and effort. We are about to come up with some thoughts on how to determine whether a sequence represents a new subtype. Stay tuned!

Scientific Output From My Blastocystis Research

My Blastocystis-related publications can be viewed here:
sciseekclaimtoken-4f7b17c9121c3

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!

Blastocystis Treatment

In my opinion, in many cases we should "leave Blastocystis alone". In some cases, however, treatment may be warranted. However, currently there are no convincing drug regimens. RCTs needed.
For more information, please consult this review. 

European Congress on Tropical Medicine and International Health in CPH 2013

Don't forget the VIII’th ECTMIH in Copenhagen September 10-13, 2013, - click here to get flyer.

Why not speculate on our possibilities to host a symposium/work shop on Blastocystis? Potential topics:

1) Blastocystis in the "omics" era - possibilities and perspectives
2) Recent advances in Blastocystis research
3) Standardisation in Blastocystis epidemiological research methodologies

We have been colonised!

Time to revisit: Why it is a bugs life by Jörg Blech (The Guardian (2002)). Speaking of numbers, - I wonder which one is the most successful eukaryote in terms of numbers? Blasto?