This Month in Blastocystis Research (JAN 2016)

Three publications have caught my attention over the past month.

The first one is by my Turkish colleagues Kurt, Dogruman-Al, and Tanyüksel. They just published the paper "Eradication of Blastocystis in humans: Really necessary for all?" This title implies that treatment of Blastocystis is recommendable in some cases. The authors appear to acknowledge the view that treatment should be given to symptomatic carriers when all other causes of gastrointestinal symptoms have been rule out, - the popular 'last-resort' approach.

What I think is really useful and admirable is that the authors leave so many questions open/unanswered, despite the fact that they have been "in business" for so many years, representing some of the most avid Blastocystis researchers. It becomes clear from reading the paper that even in 2016, we still do not know how to eradicate Blastocystis from the intestine in those cases where we'd really like to try and do so. Importantly, the authors give examples of data supporting the fact that treatment failure may be due to failure of the drug to reach the parasite as well as treatment resistance. They also highlight the possibility that eradication of Blastocystis by antibiotic/anti-protozoal agents may be due to microbiota perturbation rather than a direct action on Blastocystis. I also very much appreciate the fact that the authors are embracing the necessity of studying Blastocystis in a parasite-microbiota-host context in order to be able to draw useful conclusions on its role in human health and disease.

Das and colleagues just published data on Blastocystis and subtypes of Blastocystis in IBS patients and controls in New Delhi, India. Using multiple traditional and DNA-based methods, they found that in their study material, the prevalence of Blastocystis was higher among patients with IBS than among healthy controls. It is not exactly clear how the controls were picked and what type of study population they represented. What I found really useful is the fact that they not only carried out subtyping of Blastocystis, but also identified subtype alleles. The subtypes and alleles found in the study were very similar to those found recently by Pandey et al. (2015) in Maharashtra, India.  Interestingly, it appears that only two subtypes are found in humans in India, namely ST1 and ST3. However, only two studies from India are available on subtypes in humans, to my knowledge, and so we need much more data to draw conclusions.

The last paper that I'm going to address is one by Zanzani and colleagues. When I read the abstract I almost dislocated my lower jaw from stupefaction: Studying the gastrointestinal parasitic fauna of captive non-human primates (Macaca fascicularis), they found a variety of protozoa and helminths, which is not surprising at all. Neither is it surprising that most macaques were positive for Blastocystis. Now, what really made my jaw drop was the fact their data on the subtypes found in the macaques challenged the host specificity of Blastocystis identified so far: They reported finding ST1, ST2, ST3, ST5, and ST7. And so, I had a closer look at the methods used to obtain data on subtypes. I take the liberty of questioning the data, since the authors report using a set of primers for amplification of Blastocystis DNA targeting the SSU rRNA gene, while using the STS primers developed by Yoshikawa et al. as sequencing primers! I guess that it is possible that the description of the methods was flawed (should have been picked up by the reviewer though), in which case I hope that an erratum will be developed and published.

References:

Das R, Khalil S, Mirdha BR, Makharia GK, Dattagupta S, & Chaudhry R (2016). Molecular Characterization and Subtyping of Blastocystis Species in Irritable Bowel Syndrome Patients from North India. PloS One, 11 (1) PMID: 26784888  

Kurt Ö, Doğruman Al F, & Tanyüksel M (2016). Eradication of Blastocystis in humans: Really necessary for all? Parasitology International PMID: 26780545

Pandey PK, Verma P, Marathe N, Shetty S, Bavdekar A, Patole MS, Stensvold CR, & Shouche YS (2015). Prevalence and subtype analysis of Blastocystis in healthy Indian individuals. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases, 31, 296-9 PMID: 25701123  

Zanzani SA, Gazzonis AL, Epis S, & Manfredi MT (2016). Study of the gastrointestinal parasitic fauna of captive non-human primates (Macaca fascicularis). Parasitology Research, 115 (1), 307-12 PMID: 26374536  

Yoshikawa H, Wu Z, Kimata I, Iseki M, Ali IK, Hossain MB, Zaman V, Haque R, & Takahashi Y (2004). Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries. Parasitology Research, 92 (1), 22-9 PMID: 14598169

This Month in Blastocystis Research (FEB 2015)

Before heading off to visit dear colleagues at the Public Health Agency of Sweden tomorrow morning, I thought I'd do a quick 'This Month...' post.

Tropical Parasitology has published a paper by Elghareeb and colleagues on  'Laboratory Diagnosis of Blastocystis in Diarrheic Patients'. I was asked to do a Guest Commentary on their paper, and if your're interested you can download my comments here for free (html version). The paper by Elghareeb et al. should also be free for download at the website.

I have been very lucky to work together with Dr Prashant K Pandey and his colleauges in Pune, India. Together we just published the first data on Blastocystis subtypes ever to appear in India for what I know. We subtyped Blastocystis in a cohort of healthy Indian individuals, and found ST1 and ST3 in 27/100 adult individuals tested, while other common subtypes, ST2 and ST4, were absent. Remarkably, ST3 was seen in all positive individuals, while ST1 was seen only in mixed infections. The strains (alleles) found in India were no different to those found in for instance Europe.

There is a paper out by Rossen and colleagues from The Netherlands showing that Blastocystis is relatively uncommon in patients with active ulcerative colitis (UC) and significantly less common in UC patients (13.3%) than in healthy individuals (32.5%). This is completely in line with data that we generated in Denmark a couple of years ago. In fact, at two separate occasions we have been able to look into patients with inflammatory bowel disease. In both cases (one study has been submitted for publication), hardly any Blastocystis was found in patients with Crohn's disease, while a few patients with UC were positive; however, mostly patients with inactive disease appeared to have Blastocystis, while those with flare-ups were negative. Therefore, the influence of dysbiosis on Blastocystis colonisation should be subject to further scrutiny.

A lot of action goes on at the official website for the 1st International Blastocystis Symposium in Ankara in May, with exactly three months to go! Why not take a minute to browse the programme for the Pre-Symposium Course and the Scientific Programme for the actual Symposium? Please go here to familiarise yourself with the new content. 
Also, conference abstracts are pouring in, - did you submit yours yet?

References

Elghareeb AS, Younis MS, El Fakahany AF, Nagaty IM, & Nagib MM (2015). Laboratory diagnosis of Blastocystis spp. in diarrheic patients. Tropical Parasitology, 5 (1), 36-41 PMID: 25709951

Stensvold, C. (2015). Laboratory diagnosis of Blastocystis spp Tropical Parasitology, 5 (1) DOI: 10.4103/2229-5070.149885  

Pandey PK, Verma P, Marathe N, Shetty S, Bavdekar A, Patole MS, Stensvold CR, & Shouche YS (2015). Prevalence and subtype analysis of Blastocystis in healthy Indian individuals. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases PMID: 25701123

Rossen NG, Bart A, Verhaar N, van Nood E, Kootte R, de Groot PF, D'Haens GR, Ponsioen CY, & van Gool T (2015). Low prevalence of Blastocystis sp. in active ulcerative colitis patients. European Journal of Clinical Microbiology & Infectious Diseases: Official Publication of the European Society of Clinical Microbiology PMID: 25680316

Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.

The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC

What you'll see is this:

As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:

For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).

Using STADEN for Sequence Assembly by RuneStensvold

When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.

This Month In Blastocystis Research (MAR 2014)

If there's one paper that really made my eye balls pop over the past 30 days, it's the paper appearing a couple of days ago in BMC Infectious Diseases by Safadi et al. on Blastocystis in a cohort of Senegalese children. The paper is open access and can be downloaded here. But I'll be jumping right at it:

A 100% prevalence of Blastocystis in a cohort of 93 Senegalese children! 

The children represented a mixed group of children with and without symptoms. And yes, they were all colonised!

Are Senegalese children obligate carriers of Blastocystis? Image courtesy of whl.travel.

I will not at all try and discuss the potential clinical implications of this. I don't think we currently have the appropriate tools to ascertain to which extent a 100% Blastocystis prevalence is a public health problem. 

However, technically and scientifically, I'm extremely pleased to see a study like this one. My group and some of my colleagues have somewhat similar data in the pipeline, and it's great to see this next generation of survey data emerging from different regions of the world, based on the use of highly sensitive molecular tools to screen for Blastocystis. I cannot emphasise the importance of this too much.

The authors hoovered faecal samples from the children for Blastocystis-specific DNA using both PCR + sequencing (barcode region) and real-time PCR. Importantly, quite a few samples negative by barcoding were positive by real-time PCR, and so if the authors had included only PCR + sequencing, the prevalence would have been only 75% or so. It may be not very surprising that barcoding PCR did not pick up all cases of Blastocystis, but then again, it has always been known that the barcoding PCR is not diagnostic - one of the primers, RD5, is a general eukaryotic primer, while the other one, BhRDr is Blastocystis-specific. Also, the PCR product is about 600 bp; diagnostic PCRs should preferably be designed to produced much smaller amplicons (100 bp or so) for a variety of reasons.

The research team subtyped all samples, and found ST3 to be the most prevalent subtype - colonising about 50% of the children. ST1 and ST2 were also common, while ST4 was found in only 2 children and only in mixed infections. Mixed subtype infections was seen in 8 cases. Note the small fraction of ST4. This subtype is very common in Europe but seems to be rare in most other regions.

There is no doubt that we with molecular tools are now starting to obtain data that represent a more precise snapshot of reality than before when tools of low sensitivity and unable to give strain information were used. And while qPCR can take us a long way in terms of precisely distinguishing positive from negative samples, we still have an amplification step that may interfere with the DNA information that we obtain. The French group involved in this study has over multiple studies done  an admirable job in terms of pursuing the extent of mixed subtype infections. Whether the data are based on sequencing of PCR products amplified by genus-specific primers, or whether real-time PCR  using genus-specific primers is used, it can still be argued that these methods have limitations due to application of genus-specific primers in both cases. It is going to be interesting to compare the evidence that we have collected from subtyping over the past few years with analysis of metagenomics data, which are independent of PCR amplification, and thus not subject to potential bias. 

A 100% prevalence means that transmission pressure is massive. Three subtypes are common. Still, mixed infections are present in less than 10%. If this is indeed a realistic picture, this may imply that once established, a Blastocystis strain is capable of keeping other strains at bay? In keeping with waht I said above, it is also possible that the extent of mixed infections is higher, and that the PCR methods only detect the more predominant strain, making the prevalence of mixed ST infection seem low.

It's tempting to believe that such a high prevalence of Blastocystis compared to Europe is due to exposure to contaminated water, but how does this explain a whopping 30% Blastocystis prevalence in the background population in Denmark, a country characterised by supreme hygienic standards and 'perfect plumbing' with all potable water being pumped up from the ground (ie. hardly no surface water)? Have all individuals positive for Blastocystis in Denmark been out traveling to more exotic countries with less well controlled water infrastructures? Or is Blastocystis just highly transmissible through e.g. direct contact? And will all who are exposed develop colonisation? What are the determinants? It's probably not fair to dismiss the idea of Blastocystis being waterborne (as one of the modes of transmission) due to the fact that Blastocystis has not been cause of waterborne outbreaks. If Blastocystis is non-pathogenic, it can easily be transmitted by water. In fact, if Blastocystis is waterborne and never gives rise to outbreaks, what does this tell us about it's pathogenic potential? Well, acute disease such as that seen for some bacteria, viruses, and Cryptosporidium, Giardia and microsporidia is probably not something that is associated with the organism.

I could have wished for allele analysis of the subtypes detected. It should be possible in all cases where barcode sequences were available, - simply and easy using this online tool. But the data is available in GenBank so everyone interested can have a look. 

There is plenty of interesting things to address, but for now I'll leave it here, and on behalf of all of us interested in Blastocystis research just thank the people behind the paper for publishing this important study!

And nope, this is no April Fool!

Literature:

El Safadi D, Gaayeb L, Meloni D, Cian A, Poirier P, Wawrzyniak I, Delbac F, Dabboussi F, Delhaes L, Seck M, Hamze M, Riveau G, & Viscogliosi E (2014). Children of Senegal River Basin show the highest prevalence of Blastocystis sp. ever observed worldwide. BMC Infectious Diseases, 14 (1) PMID: 24666632

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438

This Month In Blastocystis Research (AUG 2013)

Quite a few papers relevant to Blastocystis research have made it to PubMed over the past month! Therefore, the August version of 'This Month in Blastocystis Research' is more like a list of papers + short descriptions/comments, rather than one or two actual paper reviews.

Dr Aldert Bart and his Dutch colleagues have published a study that confirms data emerging from other parts of Europe. Using microscopy (fixed faecal smears) and PCR, they found an almost 40% prevalence of Blastocystis in returning travelers with symptoms, and a prevalence of 18% in patients referred for other reasons. The distribution of subtypes found in the study population was quite similar to what has been found elsewhere in Europe with ST3 predominating (42%) and the rest of the subtypes attributable to ST1 (22%), ST2 (22%), ST4 (12%), ST6 (1%) and ST7 (1%).

The Tropical Parasitology theme issue on Blastocystis has now gone live. You’ll find a link to the editorial and the three papers included in the symposium here.

In my previous post I referred to a new study from Colombia which includes subtyping of Blastocystis isolates from humans, and a variety of animals, including birds. The paper is interesting for a number of reasons, but first and foremost it confirms the virtual absence of ST4 in humans in S America. Moreover, the study included 70 Blastocystis positive samples from asymptomatic carriers, 40 positive samples from patients with diarrhoea, and 15 positive samples form patients with IBS. Remarkably, all samples from healthy carriers were typed as ST1, those from patients with diarrhoea belonged to ST2, and those from IBS patients to ST3. Such a clear-cut distribution of subtypes across cohorts is unprecedented and of course warrants confirmation and further investigation. In Europe, ST4 is very common in humans, while it appears rare in humans in many other parts of the world. ST4 also appears rare among non-human primates (NHPs), our closest living relatives, and while NPHs and humans otherwise tend to share the same major subtypes (ST1, ST2, and ST3), this suggests that while subtypes 1, 2 and 3 have probably co-evolved with primates, ST4 has only recently entered the primate population with a preference for humans! I have hinted at this many times by now, but I find it extremely interesting which is why I keep repeating it.

There is a paper out by Santos and Rivera from the Philippines comparing microscopy of direct faecal smear with culture and PCR for detection of Blastocystis. They ended up concluding that culture was the best diagnostic modality, but it should be noted that the PCR used in the study targets a 1.8 kbp product (complete SSU rRNA gene!), and much smaller products are usually targeted in diagnostic PCR assays. The Blastocystis real-time PCR developed by me and my colleagues targets a sequence stretch of ~120 bp, securing optimum test sensitivity. The results of the Philippine study should be interpreted with this in mind.

Li et al., have published data on experimental infection of ST1 in Sprague-Dawley rats. Animals belonging to this species appeared susceptible to a ST1 strain isolated from a diarrhoeic patient that had been kept in culture and for which induction of cysts had been performed with a view to infecting the rats. The study confirms that Blastocystis is mainly a parasite of the coecum and colon. The authors found evidence of Blastocystis invasion into the lamina propria in one of the animals, and signs of inflammation in all animals challenged. While it is great to see that experimental models can be sustained and that encystation can be induced in vitro, at least two important factors must be kept in mind to fully comprehend the study: Although cysts were isolated by gradient centrifugation prior to inoculation, it is unlikely that all bacteria have been removed from cyst suspensions; in other words, the cyst preparation is not likely to be 'sterile', and any effect of the potentially accompanying bacterial flora is difficult to determine. Moreover, rats may not be natural hosts of ST1 (very few data available on the topic!), and so, the pathology caused in the rats may be an unlikely finding in humans, who are indeed natural hosts of ST1 and may have developed a high degree of tolerance to this subtype.

Are dogs, wolves, and other canids natural hosts of Blastocystis?

When visiting Australia earlier this month, I had the pleasure of meeting Wenqi Wang and Tawin Inpankaew, both PhD students working at School of Veterinary Science, The University of Queensland Gatton Campus and supervised by Dr Rebecca Traub. One of the foci of this group is to study Blastocystis in animals, for instance in households where animals are kept as pets. Recently, a paper emerged from this group on diversity of Blastocystis subtypes in dogs in different geographical settings, hence domestic/pound dogs from Brisbane, Australia, semi-domesticated dogs from a village in Cambodia, and stray dogs from Mumbai and other Indian cities. Using sensitive PCR methods they observed that almost one fourth of the Indian dogs were infected, while dogs in the Cambodian village and in Queensland remained largely uninfected. Coprophagy and access to Blastocystis-positive stool from different hosts may account for the relatively high prevalence in stray dogs in India, although one might assume that the prevalence would then be even much higher? The team used nested PCR in their study and found four different subtypes in the Indian dogs, including ST1, ST4, ST5 and ST6. Whether all of their data collectively indicate that dogs are not natural hosts of Blastocystis is a matter of debate and remains to be more thoroughly investigated. Indeed, prevalence and subtype data from studies of samples from wild life canids (dingos, jackals, wolves, coyotes, but also foxes and raccoon dogs) would shed further light on this topic.

Finally, for those interested in how Blastocystis deals with oxidative stress and related metabolic issues, there is a paper out on iron-sulphur cluster biogenesis in protozoan parasites by Ali and Nozaki citing works by Tsaousis (2012), Denoeud (2011), Long (2011), and Stechmann (2008).

Literature:

Ali V, & Nozaki T (2013). Iron-sulphur clusters, their biosynthesis, and biological functions in protozoan parasites. Advances in Parasitology, 83, 1-92 PMID: 23876871

Bart A, Wentink-Bonnema EM, Gilis H, Verhaar N, Wassenaar CJ, van Vugt M, Goorhuis A, van Gool T. Diagnosis and subtype analysis of Blastocystis sp. in patients in a hospital setting in the Netherlands. BMC Infectious Diseases, 13:289.

Li J, Deng T, Li X, Cao G, Li X, & Yan Y (2013). A rat model to study Blastocytis subtype 1 infections. Parasitology Research PMID: 23892480 DOI: 10.1007/s00436-013-3536-7

Parija SC (2013). Blastocystis: Status of its pathogenicity. Tropical Parasitology, 3 (1) PMID: 23961433

Parija SC, & Jeremiah S (2013). Blastocystis: Taxonomy, biology and virulence. Tropical Parasitology, 3 (1), 17-25 PMID: 23961437 

Ramírez JD, Sánchez LV, Bautista DC, Corredor AF, Flórez AC, & Stensvold CR (2013). Blastocystis subtypes detected in humans and animals from Colombia. Infection, Genetics and Evolution : Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases PMID: 23886615

Sekar U, & Shanthi M (2013). Blastocystis: Consensus of treatment and controversies. Tropical Parasitology, 3 (1), 35-9 PMID: 23961439

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438  

Wang W, Cuttell L, Bielefeldt-Ohmann H, Inpankaew T, Owen H, & Traub RJ (2013). Diversity of Blastocystis subtypes in dogs in different geographical settings. Parasites & Vectors, 6 PMID: 23883734

Birds of America

Yesterday evening, I was watching another compelling BBC production, broadcast on Danish television: Earthflight, North America. In quite a unique way, the viewers got the rare opportunity to see through the eyes of birds such as eagles, geese, and pelicans and follow birds as they were migrating, escaping, hunting for prey, etc. It made me think of the 19th century masterpiece 'Birds of America' by John James Audubon, which can be viewed in the National History Museum in London. The book features 435 stunning hand-coloured plates that show birds life-size, in natural positions and in their natural habitat.

One of the things that I find interesting - and quite unexplored - is Blastocystis in birds. By 'unexplored' I mean that relatively little sampling has been done, and so the number of observations of Blastocystis in birds is still limited compared to other types of hosts. However, there is a brand new paper out in 'Infection, Genetics and Evolution' which includes observations on Blastocystis in birds (of America!).

You see, I was invited in on a study by colleagues in Colombia who had access to DNA from quite a few faecal samples from a number of host species, including feral birds, and what we found confirms the quite unambiguous trend seen so far: Birds - no matter where on this planet - appear to be colonised mainly by ST6 and ST7. As a matter of fact, in the present study only ST6 was seen in almost 50 Colombian passerine birds of varying species, most of which I believe are limited in geographical distribution to the Americas: Passer domesticus, Thraupis episcopus, Oryzoborus maximiliani, Sicalis flaveola, and Petrochelidon pyrrhonota. Moreover, only one allele of ST6, allele 122, was identified. Notably, the prevalence of Blastocystis in the sampled bird population was 90%. I believe that this is the first official report on Blastocystis in passeriformes. Other major groups of birds previously sampled include galliformes, anseriformes, and ratites (Stensvold et al., 2009; Alfellani et al., 2013).

Other subtypes have been reported in birds (Alfellani et al., 2013), but due to the very low number of samplings these subtypes may be more or less co-incidental/abberant findings. Of note, some samples from birds have been untypable. I have a slight recollection of detecting ST3 in Icelandic rock ptarmigans (in mixed ST infection) collected by Dr Karl Skírnission, but that certainly needs confirmation.

Bird contact/bird droppings - a significant source of Blastocystis in humans? Me feeding some 'Birds of Australia'. Photo by Dr Rebecca J Traub.

ST6 is very rarely seen in humans in Europe. In other parts of the world, for instance in Egypt and some Asian countries, ST6 appears relatively common, but we do not know much about 'bird subtypes' in those particular regions. Also, the situation in the US and Canada is more or less completely unknown (Blastocystis subtyping is something that appears not to attract research groups in North America apart from the one led by Dr Ron Fayer in Beltsville, Maryland).

ST7 is occasionally seen in humans in countries such as Sweden and Denmark. But in my - still limited - experience, individuals infected by these subtypes are not necessarily prone to 'suffer more' from intestinal symptoms than those who do not have these subtypes. While human cases of ST6 (and ST7) may represent cases of zoonotic transmission, it is far to early to draw any conclusions on this. It would be important to compare ST6 and ST7 18S alleles from humans and birds. MLST typing systems for these two subtypes are not yet available, but 18S analysis in itself may prove valuable for molecular epidemiological analyses as in the case of other subtypes (Stensvold et al., 2012).

Walton Ford: "Falling Bough" (Source). You will also see the now extinct Passenger Pigeon in 'Birds of America'.

References:

Ramírez JD, Sánchez LV, Bautista DC, Corredor AF, Flórez AC, & Stensvold CR (2013). Blastocystis subtypes detected in humans and animals from Colombia. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases PMID: 23886615

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574

Stensvold CR, Alfellani M, & Clark CG (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infection, Genetics and Evolution: Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases, 12 (2), 263-73 PMID: 22116021

Stensvold CR, Alfellani MA, Nørskov-Lauritsen S, Prip K, Victory EL, Maddox C, Nielsen HV, & Clark CG (2009). Subtype distribution of Blastocystis isolates from synanthropic and zoo animals and identification of a new subtype. International Journal for Parasitology, 39 (4), 473-9 PMID: 18755193

This Month In Blastocystis Research (JUN 2013)

Another paper in the string of publications coming out from the PhD study by Dr Alfellani (London School of Hygiene and Tropical Medicine) has just appeared in PubMed.

Dr Alfellani and his colleagues have done a great job in analysing a multitude of samples from humans, non-human primates and animals; I have previously blogged about their observations from studies of human and non-human primates. Moreover, they have surveyed available data in order to better discuss their own findings, and the work has contributed significantly to what today is known about the host specificity, genetic diversity, phylogeography and general molecular epidemiology of Blastocystis.

Alfellani's most recent paper is published in the journal Protist, and it deals with the 'Genetic Diversity of Blastocystis in Livestock and Zoo Animals'.

It is quite a large paper which includes a lot of new information and a comprehensive (and hopefully exhaustive) table summarising Blastocystis subtype data in all relevant hosts (humans, non-human primates, other mammals and birds).

I will highlight a couple of things from the paper:

1. Apart from reporting on virtually complete SSU rDNA sequences from a couple of subtypes for which entire SSU rDNA sequences have yet not been available, we also report on three novel subtypes. Until recently, we only knew about 14 subtypes (ST1-ST14), of which ST1-ST9 can be found in humans. Now, three additional subtypes have been identified; ST15 in artiodactyls (camel and sheep) and non-human primates (chimpanzee and gibbon), ST16 in kangaroos, and ST17 in gundis.

The Gundi (Ctenodactylus gundi) is a rodent living mainly in the deserts of Northern Africa. (Source)

2. Novel data arising from analysis of faecal samples from humans and animals in Sebha, Libya, strongly indicate that humans and animals in this area are infected by different subtypes: Humans appear to carry ST1, ST2, and ST3, while synanthropic animals (artiodactyls in this case) mostly have ST5 and ST10 infections, suggesting that livestock is not a major contributor to human Blastocystis infection.

To this end, there is growing evidence of quite a substantial degree of host specificity of Blastocystis.  Even when subtypes overlap between humans and animals, we have accumulating evidence that the strains found in humans and animals are different. This means that the hypothesis that animals constitute an important reservoir of human Blastocystis infections currently has very limited support. It is my clear impression that when a strain of ST6 or ST8 is detected in humans, this strain has most probably been transmitted from an animal source. But we very rarely see these subtypes in humans, at least in Europeans.

It will be extremely interesting to see how the universe of Blastocystis subtypes unfolds... by genetically characterising strains in humans and non-human hosts, we are building up a clearer picture of transmission patterns and evolutionary biology, including our adaptation to Blastocystis, and the parasite's adaptation to us and other hosts.

It is noteworthy that we are starting to see different subtypes in rodents. We have previously thought that generally, rodents were infected by ST4. But now we know that many rodents are not infected, and we also know that rodents may harbour subtypes other than ST4.

So,17 subtypes of Blastocystis are now known. We have probably only seen the top of the iceberg, since many host species have not yet been sampled from, and it is likely that we will see quite a few STs being identified in the nearest future. To this end it is necessary to have a consensus regarding the identification of novel subtypes. Along with the Protist paper we have uploaded a supplementary file (Appendix A, TXT format) with aligned reference sequences that can be used for phylogenetic analysis,  hoping that it will be useful to our colleagues. In a future blog post I will try to address the issues of identifying new subtypes more specifically.

ST15 is one of the more interesting subtypes since it appears to have quite a low host specificity - infecting both non-human primates and artiodactyls. Yet, we have come across it only now. ST15 and ST17 are remarkable in the way that they appear to be closer related to herptile and arthropod lineages, respectively, than to lineages from mammals.

Please note that virtually complete sequences of ST10, ST13, ST14, ST15, and ST17 analysed in the study have been released in GenBank just now.

Further reading:

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic Diversity of Blastocystis in Livestock and Zoo Animals. Protist, 164 (4), 497-509 PMID: 23770574

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980

Alfellani MA, Jacob AS, Perea NO, Krecek RC, Taner-Mulla D, Verweij JJ, Levecke B, Tannich E, Clark CG, & Stensvold CR (2013). Diversity and distribution of Blastocystis sp. subtypes in non-human primates. Parasitology, 140 (8), 966-71 PMID: 23561720