Monday, July 28, 2014

This Month In Blastocystis Research (JUL 2014)

For Spanish-speaking Blastocystis geeks, this summer must have been a real treat: Londoño-Franco and colleagues published a paper in Biomédica on Blastocystis in children and Colombia. But not only did they look for Blastocystis in faecal samples, they also sampled from finger nails, house floors, toys, tap water,  vegetables, other food items, etc... It is extremely rare to see studies aiming to identify sources of potential transmission, and I thought that this study would merit a blog post (unfortunately, I will have to rely on the Google translated version with all its potential limitations; I excuse for any misunderstandings).

Of course one of the big questions still remaining in Blastocystis research is: From where do we get this parasite? With more than one billion people colonised on the globe, the transmission pressure must be massive, and it's tempting to expect infectious cysts (or other stages) being more or less ubiquitous. There is some evidence accumulating that the parasite can be water-borne, and we also know that zoonotic transmission can occur (although relatively rarely, supposedly). However, this study takes things way further:

The authors carried out their study in Calarcá where they identified a prevalence of Blastocystis (based on microscopy of stool concentrates) of 57.5% in 275 children less than 5 years old; children aged 48 months or more were more prone to be positive than those who were younger. This is something we see a lot, and it either suggests a cumulative effect of colonisation (once established, colonisation is chronic), or that the behaviour (~exposure) or intestinal microbiota of older children favours colonisation.
Agua de panela (source).

Blastocystis was also found in dogs (63.3%), cats (56.3%), and poultry (35.7%). Moreover, it was found in tap water (38.5%), on toys (29.9%), baby bottles (18.5%), and under the nails of infected children (42.2%), their siblings (44.8%), and their mothers (34.2%). Among the vegetables that are typically consumed raw, it was found most frequently in lettuce (66.7%), and, in descending order, in tomato (44.4%), carrots (37.5%), cabbage (28.6%) and onion (25%). A high occurrence was seen in containers used to store 'aqua de panela', which is allegedly some kind of sugar water (haven't had the opportunity to sample it myself), with 47.7% of the samples positive. I believe that this drink is used as a sweetener and possibly also as a refreshment/energy drink, and maybe served with for instance cheese (image). Taken into account that Blastocystis is not exactly fussy about growth medium requirements, it may not be surprising at all to learn that this type of drink serves as a perfect stronghold for Blastocystis. 

The authors also explored a number of other things, among them i) the relative occurrence of cysts and vacuolar stages in the different types of samples and ii) whether any symptoms experienced over the past month could be attributed to Blastocystis, and iii) risk factors for colonisation. However, Google translate plays tricks on me on some of these bits, so I won't try to go more into detail with these findings. Suffice to say that the approach of distinguishing between different stages should help researchers find out more about which stage(s) that is/are responsible for transmission. Also, if for instance vacuolar stages are found in agua de panela and not cysts, then this might indicate that Blastocystis is actually growing in the drink? Which again is interesting because this would mean that Blastocystis capable of infecting humans can grow at temperatures lower than 37 degrees C.

Now, I could only have great confidence in the diagnostic work carried out by this team; however, I would have absolutely loved molecular confirmation of all of these findings. Also, maybe it would have been an idea to try and culture some of the Blastocystis found on fomites and in food/water to test for viability, or, as mentioned by the authors themselves, to test for viability using trypan blue. However, the authors should be praised for their perseverance and ingenuity, and I hope that this study will inspire other colleagues to pursue and expand on these initiatives and ideas.

This month saw a number of different Blastocystis-related papers, among them a paper from Klimes et al. on issues with Blastocystis genome annotation and polyadenylation-mediated termination codon creation in nuclear mRNA transcripts. Moreover, there's a paper on population structure analysis of seven eukaryotic microbial lineages, including Blastocystis, that apparently makes it possible to infer variable impacts of genetic exchange in populations of predominantly clonal micro-pathogens  (in fact the authors used our MLST data for ST3 in their analyses!). Finally, our colleagues in České Budějovice have produced an interesting review on self-infections with parasites; in the paper they point to the traditional focus on sussing out the pathogenic potential of parasites instead of trying to identify the potentially positive effects of parasite colonisation. Definitely worth a read!

Reference:

Londoño-Franco AL, Loaiza-Herrera J, Lora-Suárez FM, & Gómez-Marín JE (2014). [Blastocystis sp. frequency and sources among children from 0 to 5 years of age attending public day care centers in Calarcá, Colombia]. Biomedica : Revista del Instituto Nacional de Salud, 34 (2), 218-27 PMID: 24967927 

Klimeš V, Gentekaki E, Roger AJ, & Eliáš M (2014). A large number of nuclear genes in the human parasite Blastocystis require mRNA polyadenylation to create functional termination codons. Genome Biology and Evolution PMID: 25015079 

Lukeš J, Kuchta R, Scholz T, & Pomajbíková K (2014). (Self-) infections with parasites: re-interpretations for the present. Trends in Parasitology PMID: 25033775

Tomasini N, Lauthier JJ, Ayala FJ, Tibayrenc M, & Diosque P (2014). How often do they have sex? A comparative analysis of the population structure of seven eukaryotic microbial pathogens. PLoS One, 9 (7) PMID: 25054834 

Thursday, July 3, 2014

This Month in Blastocystis Research (JUN 2014) - IMECs Edition

In June there was a paper out in Frontiers in Microbiology by Laura W Parfrey and co-workers identifying the diversity of intestinal microbial eukaryotic communities (IMECs) in humans and other mammals. It's probably one of the most interesting papers I've read for a long time; maybe because it expands on many of the things I've been blogging about - or at least intended to blog about (!) - over the past two years.

What the team did was to do comprehensive analysis of IMECs in both humans and mammals using broad specificity primers for PCR and next generation sequencing technology-based sequencing of the PCR products. While I'm not in a position to validate the analysis of the data, I'd just want to highlight the importance of the approach. It is very rare to see this type of analysis, despite the fact that it's probably the best currently available approach to studying the ecology, homeostasis and public health significance of IMECs. Some of these euks have probably co-evolved with humans and other animals over thousands and thousands of years and therefore may constitute part of the habitual/commensal flora; and so a current working hypothesis (Hygiene Theory) is that losing IMECs ('defaunation' due to Western life style (excessive hygiene and changes in diet)) may prove detrimental to human health and may be one of the most important reasons why we develop for instance allergies and other autoimmune diseases.

Blastocystis virtually obligate finding in Malawi citizens?
And indeed, what the authors found was that among 23 study individuals residing in agrarian communities in Malawi, Blastocystis and Entamoeba were almost obligate findings (not found in two infants, but apart from that almost a consistent finding), while none of the 13 (somewhat age-matched) study individuals from Boulder, Colorado, were infected with Blastocystis, and only two individuals had Entamoeba coli. I was surprised to read that Dientamoeba was not detected in any of the populations; it appears that there is a strong geographical component to the distribution of this parasite, but as the authors mention, specific tools are needed to confirm the absence.

The funny thing is that although this is not a paper specifically on Blastocystis, it is probably the most interesting surveys on Blastocystis coming from the US and a very valuable Blastocystis. Data on Blastocystis in this country is really scarce, but if the prevalence of the parasite is really as low as indicated in this study, then it's maybe quite understandable! And maybe (and this is a highly presumptuous 'maybe', I know) Blastocystis might even therefore an emerging pathogen in the US? When was the US experiencing the great IMECs wipe out? Can it be confirmed? Is there - within the US - also a strong geographical compoenent to the prevalence of IMECs?

Anyway, there are many interesting observations in the paper - and please visit the supporting files. Blastocystis ST11 was confirmed in an elephant (which also hosted Entamoeba moshkovskii! Probably first report of this parasite in an animal). ST13 was found in a Gazelle; not surprisingly, but nice to see independent data confirming what few researchers have found until now. ST4 was found in a sheep and in Okapis; when it comes to ST4, I'm hardly surprised about anything; it appears to be such a sporadic finding in a diversity of non-human hosts (i.e. low host specificity and incidental); one sheep also had ST8, a subtype almost exclusively seen in non-human primates (even South American monkeys rather than for instance African monkeys and apes), so this was surprising too. ST8 was moreover found in two kangaroos (not the first time), in an okapi (different from two first ones) which also hosted ST12, and in an armadillo!

Take home messages include:

1) The study is one of the first to virtually survey IMECs in human and non-human faecal samples using NGS tools.
2) The study confirms a very high prevalence of Blastocystis in some sub-Saharan African communities (for more on this, see a previous blog post), and interestingly, the prevalence and co-infection rate of (up to four species of) Entamoeba was comparably high.
3) Data suggest that IMECs in Western populations are highly reduced compared to rural African populations, but we still need to know more about the relative distribution of for instance fungi and whether these fungi are actually colonising the gut or just carry over from ingested food; right now, it seems as if there might be an inverse relationship between fungal and non-fungal IMECs... something that we can hopefully soon gather sufficient data on for publishing.
4) For those interested in Blastocystis subtype data, including host specificity and geographical distribution, there is a lot to look at in the paper (including supplementary files).

There's a lot more to be said about this paper, but I will sort of leave it here. But please go and read it!

Reference:

Parfrey, L., Walters, W., Lauber, C., Clemente, J., Berg-Lyons, D., Teiling, C., Kodira, C., Mohiuddin, M., Brunelle, J., Driscoll, M., Fierer, N., Gilbert, J., & Knight, R. (2014). Communities of microbial eukaryotes in the mammalian gut within the context of environmental eukaryotic diversity Frontiers in Microbiology, 5 DOI: 10.3389/fmicb.2014.00298

Saturday, June 21, 2014

More Details on The 1st International Blastocystis Symposium

Over at www.blastomeeting.com we have posted information on the Organising Committee and the Scientific Programme Advisory Committee of the 1st International Blastocystis Meeting - by some nicknamed the 1st IBS (not too sure about whether this is a fitting acronym, but anyway...).

We will soon be back with more information about the venue, registration, scientific topics, and abstract submission.

Moreover, it is very likely that there will be a pre-symposium workshop on the 27th of May (the day before the conference) on diagnostic methods and tools for studying the molecular epidemiology of Blastocystis. So stay tuned here and at www.blastomeeting.com!

Thanks.

Sunday, June 1, 2014

This Month in Blastocystis Research (MAY 2014)

To me, this month was mostly about Blastocystis finding its way to the ASM 2014 general meeting. It was a huge honour for me to be one of the speakers in the Parasitology session 'Passion for Parasites', thanks to an invitation from Dr Lynne Garcia and ASM.

ASM2014 took place in Boston Convention and Exhibition Center.
It's pleasing that the Blastocystis research community is continuously expanding. I currently have contact to several research groups who are venturing into Blastocystis research, including epidemiology, genome sequence analysis, and Blastocystis (and other intestinal microbial eukaryotes (IMEs)) as part of the human intestinal microbiome. At the ICOPA2014 conference in Mexico in August, there will be a full session on Blastocystis from an IBS perspective with talks by Dr Pablo Maravilla, Kenneth Boorom, Dr Pauline D Scanlan and myself. There will also be a pre-congress workshop on molecular parasitology which will include Blastocystis subtyping arranged by Dr Juan David Ramirez Gonzalez and myself.

This month we also launched the website for the 1st International Blastocystis Symposium, which can be accessed at www.blastomeeting.com  - we hope that the meeting will receive great interest and contribute to promoting research on Blastocystis and other IMEs. Please go to the site to sign up for updates.

Moving on to 'paper of the month', I would just briefly highlight a study by Wu, Mirza and Tan, who used Caco-2 human colonic cells and different strains of Blastocystis sp. ST4 and ST7 to compare and demonstrate the strains' relative ability to adhere to enterocytes and to disturb cell barrier function. The paper is very interesting for a variety of reasons. For instance it appears that metronidazole resistance may be linked to a fitness cost as indicated by reduced adhesion ability.

But it would be nice to know how the results reflect the in vivo situation: What actually happens in the colon? It may be so that Blastocystis can adhere to enterocytes and even inflict damage as indicated in the paper, but what if Blastocystis is not able to make it anywhere near the enterocytes?

Now, some parasites are intracellular - e.g. Cryptosporidium and microsporidia -, Giardia has a ventral disc by which it can latch on to the intestinal lining; Entamoebas are motile, etc. Blastocystis is neither intracellular, nor is it motile, but can it attach to enterocytes or is it simply being 'kneeded' and passed along with the remaining luminal content by peristalsis? Or is it lodged in the mucus layer perhaps - trapped by chance, or actively making its way to/through it?

In the colon, two mucus layers exist; an inner layer void of bacteria, and an outer layer that serves as a home for some bacteria but that also prevents these bacteria from reaching the inner layer. Hence, the colon inner mucus layer separates the intestinal lining from the trillions of bacteria inhabiting our large intestine and as such has a tremendously important role in limiting bacterial contact with the epithelium and moving bacteria distally. Mucus is produced by our goblet cells and is made up by mucins, highly glycosylated proteins that we cannot degrade. Moreover, these mucins serve as food for commensal bacteria and are highly resistant to protease activity unless destabilised. The mucus layer traps antimicrobial peptides and other immune effectors and hence creates an effective barrier between the mucosal lining and the microbiota.

Some pathogenic bacteria, and also Giardia for instance, have flagella that allow them to move against the flow caused by secreted mucins, towards the intestinal epithelium, - one way of getting past the iron doors of the mucus layer.

Entamoeba histolytica possesses a lectin-like adhesin that enables it to anchor to the inner mucus layer. After actively destabilising the mucus layer, E. histolytica can disrupt the mucus layer by cysteine protease activity and get into contact with enterocytes. By enzyme activity the parasite can cleave MUC2, the major intestinal mucin, and this may be an initial step in a series of events resulting in invasive disease; however, in many cases enzymatic cleavage of MUC2 may be blocked by glycosylation of the cleavage site; this may be one of the explanations why E. histolytica infection may only sometimes proceed to invasive disease.

Recently, Fayer and colleagues observed that in histology sections Blastocystis was seen to adhere to the intestinal epithelium. However, since about 98% of the mucus is water, the mucus layer may vanish completely during histological procedures with important consequences for the interpretation of observations.

I believe that the use of the mucosal simulator of the human intestinal microbial ecosystem (M-SHIME) would be nearly ideal for studying Blastocystis. M-SHIME is an in vitro dynamic gut model that takes advantage of five double-jacketed vessels, respectively simulating the stomach, small intestine and the three colon regions. The model is supplemented with human gut microbiota and mucin-covered microcosms. My colleagues and I have applied for funding in order to use this model to study Blastocystis ecology, but so far, we have not had any luck with the funding agencies.

Genome and transcriptome studies of Blastocystis should also enable us to identify whether this organism has and expresses proteins that facilitate invasion of the mucus layer and adherence to enterocytes and in which way these potential mechanisms may be influenced.



Note to iOS users: You have the option of making a 'Blastocystis Parasite Blog' app! When you're browsing the site on your iPad for instance, simply add the site to your home screen (use the arrow/box icon in the top of the browser), and there you go - you've created an app icon on your desktop!

Literature: 

Hansson GC (2012). Role of mucus layers in gut infection and inflammation. Current Opinion in Microbiology, 15 (1), 57-62 PMID: 22177113

Fayer R, Elsasser T, Gould R, Solano G, Urban J Jr, & Santin M (2014). Blastocystis tropism in the pig intestine. Parasitology Research, 113 (4), 1465-72 PMID: 24535732 

Johansson ME, Sjövall H, & Hansson GC (2013). The gastrointestinal mucus system in health and disease. Nature Reviews  Gastroenterology & Hepatology, 10 (6), 352-61 PMID: 23478383 

Van den Abbeele, P., Roos, S., Eeckhaut, V., MacKenzie, D., Derde, M., Verstraete, W., Marzorati, M., Possemiers, S., Vanhoecke, B., Van Immerseel, F., & Van de Wiele, T. (2012). Incorporating a mucosal environment in a dynamic gut model results in a more representative colonization by lactobacilli Microbial Biotechnology, 5 (1), 106-115 DOI: 10.1111/j.1751-7915.2011.00308.x

Wu Z, Mirza H, & Tan KS (2014). Intra-subtype variation in enteroadhesion accounts for differences in epithelial barrier disruption and is associated with metronidazole resistance in Blastocystis subtype-7. PLoS Neglected Tropical Diseases, 8 (5) PMID: 24851944


Thursday, May 29, 2014

Happy World Digestive Health Day!

Today is World Digestive Health Day!

The theme is 'Gut Microbes -  Importance in Health and Disease'.

United European Gastroenterology (UEG), a professional non-profit organisation combining all the leading European societies concerned with digestive diseases, has launched a short video to raise awareness of such diseases:



In 2000, 600 million patients suffered from a gastrointestinal disease. By 2025, this is predicted to double to 1.2 billion (source).

For those interested (and with access!), there is a special issue on 'The Gut Microbiome in Health and Disease' in the journal Gastroenterology, one of the most renown and established journals in the field.

I would also like to bring your attention to the 5th ASM Conference on Beneficial Microbes, September 27-30 in Washington DC. Deadline for submission of abstracts is July 14.

Wishing everyone a nice World Digestive Health Day!

Saturday, May 17, 2014

Blastocystis Conference Website Launched!

I have the pleasure of introducing the official website for the 1st International Blastocystis Symposium scheduled for the 28-29 May, 2015, in Ankara, Turkey.

Please go to www.blastomeeting.com to visit and bookmark the page and to subscribe to updates via email or rss.

We'll be back shortly on the site with updates on the scientific committee, the venue, and how to submit abstracts (including deadline).

Please share. Thanks.

Wednesday, May 14, 2014

Planet Blastocystis

Well, no, this is not the Sun or Jupiter or any other gaseous galactic giant, nor is it Olympus Mons at half past nine, - but it's something quite as fascinating: Blastocystis. Even Blastocystis seen in a beautiful trichrome-stained fixed faecal smear viewed through a light microscope.

The image was sent to me by Dr Funda Dogruman-Al, Gazi University of Ankara. Colours and image quality have been manipulated a bit, - but especially the background colour may in fact vary substantially in trichrome stained preparations. I can point out at least five Blastocystis... even six, I think, like islands in an archipelago of microbes and debris, - reminiscent of volcanic craters with molten lava scarring the surface of a planet...


... which reminds me of an article from the magazine 'Microbe' (which I'm so fortunate to get in hard copy every month - sent to my office - what an immense luxury) by Arturo Casadevall and Ferric C Fang on the advantages and drawbacks on specialized science (April 2014 issue). In the article they cite a passage attributed to Konrad Lorenz:
Every man gets a narrower and narrower field of knowledge in which he must be an expert in order to compete with other people. The specialist knows more and more about less and less and finally knows everything about nothing.
After ten years of Blastocystis studies, it's not strange that you begin to feel the gravitational pull of Planet Blastocystis - orbiting in a remote corner of the Microbiology Galaxy, however rewarding life there may be... I therefore second the strategies brought forward in the article 'Specialized Science' to mitigate the drawbacks of specialisation, and from personal experience I believe that it is extremely important to throw yourself into a different scientific field - at least for a short while. I also think that if we keep asking ourselves why we are doing what we're doing, this will to some degree prevent us from ending up too high in our ivory towers... or spending too much time on Blastocystis - or on any other planet.

While you're here: Why not take a sneak peek at www.blastomeeting.com ?

Saturday, May 10, 2014

Parasite-Microbiota-Host Interactions

One of the current mantras in microbiology is that 'bacterial cells in the human body outnumber human cells 10 to one'. This has been known for a long time, but I guess that the main reason why this is being hyped nowadays is due to the fact that current technologies now enable us to look at entire microbial communities in a given ecological niche at any time point and how for instance they relate to health and disease.

Casadevall and Pirofski already made this point clear back in 2000 in their great minireview in the journal Infection and Immunity on 'Host-Pathogen Interactions: Basic Concepts of Microbial Commensalism, Colonization, Infection, and Disease'. This is a great paper that helps us understand and distinguish between the many ways microbes impact on our body. First and foremost, it allows us to understand that microbes can be commensals in some hosts but cause disease in other hosts, and that very few microbes are obligate pathogens.

Anatomical drawing of abdomen, ca. 1900 (Elisa Schorn). Source.

Commensalism is defined by these authors as 'a state of infection that results in either no damage or clinically inapparent damage to the host, though it can elicit an immune response'. And a commensal is a 'microbe that induces either no damage or clinically inapparent damage after primary infection; a state that is thought to be established early in life'. In terms of the antibody response, 'it is not known whether these immune responses reflect the occurrence of an unidentified form of damage to the host'. Importantly, 'commensals also synthesise metabolites that are essential nutrients for the host'.

According to Casadevall and Pirofski, colonisation is 'a state of infection that results in a continuum of damage from none to great, with the latter leading to the induction of host responses that could eliminate or retain the microbe, or progress to chronicity or disease; for organisms that induce no damage during infection this state is indistinguishable from commensalism'.

I guess that to this end comes the concept of tolerance...Some single-celled parasites are common in young mammals such as calves and lambs (for instance Cryptosporidium and - it appears - microsporidia (unpublished data)), but appear to be cleared by host immune response mechanisms, while other parasites are establishing chronic colonisation, - parasites such as Entamoeba and Blastocystis. The latter parasites may also colonise humans for years on end... So why do we not eliminate these parasites? Blaser writes back in 1997: 'Failure to eliminate the parasite implies that the cost to the host is greater than the benefit. This may be due to high costs (e.g., loss of vital (...) functions), or significant benefits (e.g., protection against lethal diseases), or that both cost and benefit are relatively low'.

In Blastocystis research most scientists appear to be preoccupied by identifying a role for Blastocystis in disease, driven by the black and white concept that either it's pathogenic or not... or at least that if it can cause disease, it's by definition a pathogen! I think the paper by Casadevall and Pirofski shows with great clarity why we should try and take a much more differentiated view on Blastocystis and it's role in health and disease.

As mentioned in a previous blog post, Blastocystis is practically an obligate finding in some societies, while more rare in others. In some communities it may be common to contract it in very early childhood (infants/toddlers), while in other communities you may not be infected or infected only in adulthood. In Denmark, the prevalence in the healthy adult population is about 30%, and there may be countries where the prevalence is even lower - typically in regions, where the general population has been 'intestinally defaunated' (presumably due to excessive hygiene combined with a Westernised diet). And so, in some places this parasite is getting so uncommon that it may at some point become a cause of disease, a so-called 'emerging pathogen'... Conjectural maybe, but still not far fetched.

Simultaneously, evidence is emerging that intestinal microbial eukaryotes (Blastocystis and Dientamoeba fragilis) are significantly more common in healthy individuals than in patients with gastrointestinal disease such as IBS and - especially - IBD, suggesting that these parasites are protective of functional and organic bowel disease. Do they prime our immune system in a beneficial way? Do they select for beneficial bacteria? Do they keep potential harmful microbial intruders at bay? Could they be synthesising metabolites beneficial to the host just like ciliates involved in fermentation processes in the large intestine of various herbivorous mammals?

This is why the exploration of the structure and function of intestinal pro- and eukaryotic communities is so important. For instance, can we link Blastocystis to any intestinal microbial patterns? At our lab, we think we can, and it's something that we will try and explore further (if funding can be obtained). Our null hypotheses include the following:

1) The distribution of pro- and eukaryotes is random (for instance: Blastocystis is not statistically associated with the presence of particular bacteria or other eukaryotes (fungi, parasites)).

2) The introduction of a Blastocystis strain into an intestinal microbial niche does not cause alteration of the composition of the pro- and eukaryotic flora. This can be studied using an animal model, and it is tempting to try and study host immunological parameters during and after challenge with Blastocystis. Also gene expression in both host and microbial communities could be studied.

Take home message is that we should be cautious with regard to deeming a parasite as being either 'pathogenic' or 'non-pathogenic'... parasites may have a multitude of functions and may impact their hosts in a variety of ways that together with all other types of impact from and interactions with other microorganisms (microbiota) results in a health/disease matrix in every single individual.

Finally: Here's to pageview # 200,000! See you in Boston on Sunday morning at the #ASM2014 conference: Passion for Parasites !

Literature:

Blaser, M. (1997). Ecology of Helicobacter pylori in the human stomach. Journal of Clinical Investigation, 100 (4), 759-762 DOI: 10.1172/JCI119588  

Casadevall, A., & Pirofski, L. (2000). Host-Pathogen Interactions: Basic Concepts of Microbial Commensalism, Colonization, Infection, and Disease. Infection and Immunity, 68 (12), 6511-6518 DOI: 10.1128/IAI.68.12.6511-6518.2000

Thursday, May 1, 2014

This Month In Blastocystis Research (APR 2014)

Due to all sorts of activities I have not been able to update myself with 'novelties' in the scientific Blastocystis literature lately.

Instead, I would like to highlight two review/opinion papers on the use of PCR-based methods for diagnosis of intestinal parasitic infections in the clinical microbiology laboratory.

Both papers have been published very recently (actually one is still 'in press'). The first is co-authored by Jaco J Verweij and myself, and appears in the April issue of 'Clinical Microbiology Reviews'. This paper aims to provide a relatively systematic review of the extent and relevance of PCR- and sequencing-based methods for diagnosis and epidemiology studies of intestinal parasites, and is as such an inventory of all sorts of DNA-based diagnostic and typing modalities for individual protists and helminths.

The second one is authored solely by Jaco J Verweij and is currently in the 'first online' section in the journal 'Parasitology'. This paper offers a discussion of the application of PCR-based method as a supplementary tool or a substitute for conventional methods (microscopy, antigen detection, etc.). Dr Verweij deals with central questions such as 'Is Molecular Detection Good Enough?' and 'Is Molecular Detection Too Good To Be True?'.

And so these two papers complement each other quite well. For those interested in the very low prevalence of intestinal helminth infections in the Western world, the latter paper has a table which summarizes some quite stunning data.

Although DNA-based methods currently in use do have quite a few limitations, I do believe that for a long while the application of species- and genus-specific PCR methods (real-time PCR, conventional PCR + sequencing, etc.) will appear relevant and state-of-the-art. Dr Verweij, I and a few of our colleagues around the world are currently discussing to which extent next generation sequencing methods can be used to
  • generate data that can assist us in identifying the role of pro- and eukaryote microbial communities in health and disease
  • serve as a tool to generate sequences that can be processed by designated software and thereby identify patterns of microbial communities associated with various disease and health conditions
To this end, at the Laboratory of Parasitology, Statens Serum Institut, we are currently assisting in the development of a software called BIONmeta. BION meta is an open-source package for rRNA based pro- and eukaryote community analysis. Like Qiime and Mothur it is open source but with a growing number of advantages. The package has so far been developed mostly by Niels Larsen (DK), one of the original Ribosomal Database Project authors. It is as yet unpublished, but has been selected for in-house trial-use by companies and institutions that also partly sponsor its development.When relevant, I'll post more information on this software.

References:

Verweij JJ, & Stensvold CR (2014). Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clinical Microbiology Reviews, 27 (2), 371-418 PMID: 24696439

Verweij, JJ. (2014). Application of PCR-based methods for diagnosis of intestinal parasitic infections in the clinical laboratory Parasitology, 1-10 DOI: 10.1017/S0031182014000419

Thursday, April 10, 2014

Resources For Blastocystis Epidemiology Research

 I often get questions related to Blastocystis epidemiology research, and many of these are 'how-to' questions.

And as announced, I've chosen to dedicate a separate post listing some easy-to-use tools for subtyping Blastocystis from humans and animals.

First, I want to guide your attention to the YouTube video that I made; it takes you through various important steps of subtyping and introduces you to the online database that can be used to call subtypes by BLASTing batches of fasta files - provided that they are the right ones! And what do I mean by 'right ones'? Well, in order to get subtype information in a split second you need to have DNA sequences covering the first 500 base pairs (5'-end) of the Blastocystis small subunit (SSU) rRNA gene.


The online query database can be found here, and as you can see, it has a 'Sequence and profiles definition' section and an 'Isolates database' section; for now, never mind the latter. Now, to test this, press the 'Sequence and profiles definition', press the 'Sequence query' link, copy the following fasta file and paste it into the query box:

>gi|359391562|gb|JN682513.1|
CTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTGACTTTGAA
ACTGCGAATGGCTCATTATATCAGTTATAGTTTATTTGATGAACAATACTACTTGGATAACCGTAGTAAT
TCTAGAGCTAATACATGACAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAAGAGACT
TCGGTCTATTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTC
TGCCCTATCAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTT
CGATTTCGGAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCA
ATCCTGACATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAA
CAATGTACAAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCT
CCAATAGCGTATATTAACGTTGTTGCAGTTAAAAAGCTCGTAGTTGAATTGAAGTGAACTTGGATTGATG
TGATCTTCGGATGACGTGAATCAAAGTTGACTCTTTCCAAAGTCAATACATTGGTATTCATTTATCTTTG
TAT

 Submit your query, and then what you see is this:

Which means that a 100% identify was found and that what you pasted in was ST4, allele no. 94. This allele belongs to the rare genotype of Blastocystis. sp. ST4.

Now, even if you have a non-Blastocystis sequence, you will sometimes get a result providing the gene region is the correct one, and this is where to exert great awareness. Below is a sequence of Saccharomyces cerevisiae, which may be amplified by the barcoding primers; try and paste it into the query box and submit it for analysis:

>Saccharomyces_cerevisiae_(J01353)
TATCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTTATACAGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTTCCTTTACTACA
TGGTATAACCGTGGTAATTCTAGAGCTAATACATGCTTAAAATCTCGACCCTTTGGAAGAGATGTATTTATTAGATAAAAAATCAATGTCTTCGGACTCTTTGATGATTCATAATAACTTTTCGAATCGCATGGCCTTGT
GCTGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAATAAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGA
AGGCAGCAGGCGCGCAAATTACCCAATCCTAATTCAGGGAGGTAGTGACAATAAATAACGATACAGGGCCCATTCGGGTCTTGTAATTGGAATGAGTACAATGTAAATACCTTAACGAGGAACAATTGGAGGGCAAGTCT
GGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACTTTGGGCCCGGTTGGCCGGTCCGATTTTTTCGTGTACTGGATTTCCAACGGGGCCTTTCCTTC


What you'll see is this:


As you can see, there are many mismatches in the alignment.. so this is not allele 42 (ST4), of course not, it's not even Blastocystis!  This is why I suggest you always nucleotide BLAST your fasta files at the NCBI database (use this link). Only if they match Blastocystis, go ahead and call the subtype and the allele using the pubmlst.org/blastocystis database.

If you have a Blastocystis sequence that exhibits polymorphism compared to the reference sequences in the Blastocystis database, it may be due to one of two reasons: 1) The sequence may be unclear and/or edited erroneously, or 2) the sequence represents a new allele or a new subtype.

This means that if your sequence does not fit 100% with those in the database, I suggest you have a meticulous look at it, and if there are unclear sections, then re-sequence the whole lot - preferentially bidirectionally. If you end up with a clear sequence which still exhibits one or more polymorphisms, then please submit it to the database - you can do so be contacting the curator, who is basically me.

What you want is sequences looking like this:



For sequence editing you may want to use CHROMAS or FinchTv. These are good for single nucleotide sequence editing. If I do bidirectional sequencing or in cases where I'm having multiple sequences covering a gene (for instance when I'm sequencing complete SSU rRNA genes), I use STADEN Package; installing it may be a pain, though, make sure you use the right browser for starters... Once it has been installed, it works brilliantly, and the SOP I made for it is available below (please note that I made this SOP a couple of years ago; more recent software versions are on the market).




When is a subtype a novel subtype? Well, we addressed this question in our recent review in Advances in Parasitology. If you cannot access this journal, I suggest you look it up in the LSHTM Online Library - where you can find the pre-print version (go here to download). If you think you're dealing with a new subtype (less than 97-98% identity to reference sequences in GenBank), I suggest you look up this blog post. Importantly, please note that there is an alignment of reference sequences (representing all the 17 subtypes currently known) here - however, it requires access to the journal (and then look up 'Supplementary content' - there's a notepad file you can download). I can hope for colleagues using this alignment for phylogenetic analysis of Blastocystis SSU rRNA genes, since this is one important step towards further standardisation of Blastocystis terminology.

Other useful free online software:

For quick nucleotide alignments (groups your sequences in clusters) you can use MultAlin - chose the DNA - 5-0 option from the alignment parameters drop down menu.Trick: I usually do alignments in MultAlin and once I get the alignment, I choose the 'Results as fasta files' option (scroll to the bottom of the page), - this gives you an inventory of aligned fasta files that you can copy and paste directly into the 'build DNA alignment' function in MEGA6... now you can for instance search for specific DNA signatures (this option is not available in the MultAlin output unfortunately) and you can do phylogeny too.

And so, for alignment and phylogeny, I recommend MEGA6 or any more recent version.

Useful papers:

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158 

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257 

Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, & Clark CG (2013). Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164 (4), 497-509 PMID: 23770574 

Stensvold CR (2013). Blastocystis: Genetic diversity and molecular methods for diagnosis and epidemiology. Tropical Parasitology, 3 (1), 26-34 PMID: 23961438 

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980 

Clark CG, van der Giezen M, Alfellani MA, & Stensvold CR (2013). Recent developments in Blastocystis research. Advances in Parasitology, 82, 1-32 PMID: 23548084

Stensvold CR, Ahmed UN, Andersen LO, & Nielsen HV (2012). Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. Journal of Clinical Microbiology, 50 (6), 1847-51 PMID: 22422846

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Moreover, London School of Hygiene and Tropical Medicine Online Library currently comprises 25 papers on Blastocystis, most of which can be accessed for free (pre-print version) here.

This blog post might be updated later on, and so you may want to subscribe to blog updates - you can do so using the designated function in the sidebar.If you have any suggestions to how to improve this post, feel free to contact me.