Showing posts with label barcoding. Show all posts
Showing posts with label barcoding. Show all posts

Monday, November 2, 2020

The Blastocystis PubMLST database now has a new look!

Thanks to Keith Jolley and colleauges, the PubMLST site now has a new look! Why not try and visit the Blastocystis section? It's available here. 

The Blastocystis database has mostly been used to identify whether subtypes that are shared between humans are animals reflect the same strains or not based on intra-subtype genetic variation (allele analysis), for which is works quite well. For this purpose, you should use DNA sequences reflecting the barcode region.

 You can query a single sequence or a whole batch of sequences. On the landing page, simply press 'Typing' and then opt for 'Single sequence' or 'Batch seqeunces', depending on what you want to analyse.

It's our ambition to expand the database with more subtype alleles, since this will allow all Blastocystis researchers interested in Blastocystis epidemiology to query their barcode sequences against a curated, standardised database. However, the genetic universe of Blastocystis is rapidly expanding, so it can be difficult to keep up! 

This site works best with Sanger sequences, or, possibly, consensus sequences generated based on next-generation sequencing of the 5'-end of the SSU rRNA gene of Blastocystis; we still haven't very much experience with the latter.


 

Wednesday, March 1, 2017

Blastocystis PhD thesis from Iraq

My colleague, Dr Haitham Sedeeq Albakri (Assistant Professor at Department of Microbiology, College of Veterinary Medicine, University of Mosul), recently defended his PhD thesis  on 'Isolation and Genotyping of Blastocystis hominis in Human and Different Animals in Erbil Province'. His work was supervised by Prof Dr Abdul Aaziz Jameel Al-Ani.

Haitham wrote me and asked if I could publish the summary on my website, so here goes:



Blastocystis is an enteric unicellular anaerobic protozoan that presents in the digestive system of the humans and different animal hosts including cattle, sheep, goats, pigs, dogs, cats and birds as well as wild animals. Blastocystis causes digestive system disorders especially the irritable bowel syndrome, while animals are considered as reservoir and infective hosts. In Iraq, few morphological studies related to Blastocystis have been done in human only, but not animals. Therefore, the study aimed to detect the presence of Blastocystis in human and animal hosts, in addition to study the morphological and genetic characteristics of this protozoan. In this present study, a total of 292 stool samples have been examined for the presence of Blastocystis, the samples were distributed as follows: humans 62, cattle 81, sheep 78, dogs 21 and cats 50. Wet mount preparation, trichrome staining and culture methods were used to study the morphological characteristics of Blastocystis. In addition, molecular characteristics have been studied by polymerase chain reaction (PCR) using universal primers to detect the presence of the Blastocystis, and subsequently subtyping of positive samples using 10 pairs of subtype-specific primers. Blastocystis also have been characterized by restriction fragment length polymorphism (RFLP) method using HinfI. Finally, DNA barcoding method has been used as a more accurate and recommended method for subtyping. The results showed that Blastocystis has been detected using wet mount preparation method in 71 (24.3%) out of 292 samples collected from all hosts including human, cattle, sheep dogs and cats. While 17/62 (27.4%), 19/81 (23.5%), 14/78 (17.9%), 3/21 (14.3%) and 18/50 (36.0%) samples were positive in human, cattle, sheep dogs and cats, respectively. The detection percentages were higher when culture method was used and 98 (33.6%) were positive out of 292 tested samples. While 28/62 (45.2%), 31/81 (38.3%), 25/78 (32.1%), 2/21 (9.5%) and 12/50 (24.0%) samples were positive in human, cattle, sheep dogs and cats, respectively. The molecular methods revealed that all cultured samples were positive using universal primers with product size 1780 bp. While positive samples subtyped using specific primers into ST3a and ST3b in humans, ST5 and ST6 in cattle and ST6 in sheep, ST1a in dogs and ST5 in cats. The RFLP technique classified the Blastocystis into seven genotypes; type I, II and III in humans, type IV, V and VI in cattle and only one type, VII, in sheep. Whereas, DNA barcoding method showed that ST2 and ST3 present in humans, ST14 in cattle and ST5 in sheep, these subtypes represent 9 isolates of Blastocystis sp. that have been successfully submitted to the GenBank of the NCBI, including 4 isolates in human, 2 isolates in cattle and 3 isolates in sheep. In conclusion, this is the first morphological and genetic study of Blastocysts in humans and animal hosts in Iraq. It is also the first time that culture method has been used in Iraq for diagnosis of this protozoan. Additionally, it is the first time that molecular characterization of different local subtypes has been confirmed in Iraq. Further studies are needed to include morphological and genetic characteristics in other animal hosts and to study the relationship between human and animal isolates in different geographical areas in Iraq, in addition to investigate the relation between Blastocystis with irritable bowel syndrome in humans.



I believe that this is the first study to include Blastocystis subtype data from Iraq. I also believe that the thesis was written mostly in Arabic. Dr Albakri's email address is haitham_albakri[at]yahoo.com

Sunday, November 3, 2013

This Month in Blastocystis Research (OCT 2013)

Thanks to Google Scholar and PubMed feeds I can keep myself relatively up-to-date with emerging Blastocystis data and 'breaking news' in the field.

One of things that have caught my attention recently, is the string of foodborne outbreaks in Sweden, due to Cryptosporidium, Cyclospora and microsporidia stemming from (presumably) imported produce. A few of my colleagues (Robertsen et al., in press) have just published a large review on the impact of globalisation on foodborne parasites - a resource that has been a long time coming, and which I hope will be read and contemplated by many. The review includes a table on parasites isolated from fresh produce (for some reason the Swedish data was not included), and among these is Blastocystis, which was identified in fresh produce from Saudi Arabia (original data published by Al-Binali et al., 2006). Apart from this, hardly any data is out there on Blastocystis in the environment, and we therefore still know very little about potential sources of transmission and how we are exposed.

In Clinical Microbiology and Infection there is a paper out by Mass et al. on detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR. Not surprisingly, the study is from The Netherlands, the cradle of real-time PCR-based parasite diagnostics in clinical microbiology. It's a great paper despite all its limitations, but I couldn't figure out which Blastocystis PCR they used for the study, - I think the authors failed to provide a reference for it. Anyway, the authors found 30% of the children colonised by Blastocystis, while Dientamoeba fragilis was found in a staggering 62%, which is more or less equivalent to what we see in Denmark in this type of cohort (please refer to previous blog post on Dientamoeba fragilis). It appeared that symptom resolution was just as common in patients who were treated with different antibiotics as in patients who were not treated, and the authors end up by highlighting the fact that it is still difficult to know whom and when to test for these parasites, and when to treat them.

In Mexico, Sanchez-Aguillon and colleagues have documented a very nice study on parasitic infections in a Mexican HIV/AIDS cohort. Quite a few of the patients had Cryptosporidium, Cyclospora or Cystoisospora, the presence of which was - not surprisingly - associated with diarrhoea. Table 1 in the paper is a bit confusing, but I believe that Blastocystis was found in about 30%; of note, only ST1 and ST3 were found, adding further support to the hypothesis that ST1 and ST3 are common in most parts of the world, while especially ST4 exhibits vast differences in geographic 'affinity'. The authors end their paper by saying
"Other molecular markers for Blastocystis ST should be studied to elucidate the complexity of this heterogeneous genus and its role in human disease."
Let me just add that subtype identification is a valid proxy for intra-generic diversity in Blastocystis, - we have been looking at mitochondrial genomes and found that analyses based on mitochondrial markers and ribosomal genes reveal similar phylogenetic relationships. So, in terms of transmission and epidemiology in general, the subtyping system ('barcoding') is highly applicable and robust. It is true, however, that we need to see if we can identify specific genes potentially responsible for pathogenesis. The Mexican paper can be accessed here.

There's a very nice paper out now from the Swiss Tropical and Public Health Institute and University of Basel on differential diagnoses of common dermatological problems in returning travellers. Blastocystis has been included in the list (in the section on allergic skin reactions/urticaria) together with a plethora of other infectious agents. Lots of informative images there, and the paper has a nice structure.

Despite loads of daily feeds, a lot of papers relevant to Blastocystis research still escape my attention. I realise that there was a paper out in PLoS Genetics in June on Saprolegnia parasitica (an oomocyte parasitising on fish) which appears to be a good and interesting read. Maybe I'll come back to this one!

For me personally, this month in Blastocystis research has been a month of putting together grant proposals - more so now than usual -, many initiatives are being taken, networks are being expanded, and interesting data are accumulating from various projects... I hope to be back with details on some of this soon!

Literature:

Maas L, Dorigo-Zetsma JW, de Groot CJ, Bouter S, Plötz FB, & van Ewijk BE (2013). Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR. Clinical Microbiology and Infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases PMID: 24131443

Fabiola Sanchez-Aguillon, Eduardo Lopez-Escamilla, Francisco Velez-Perez, Williams Arony Martinez-Flores, Patricia Rodriguez-Zulueta, Joel Martinez-Ocaña, Fernando Martinez-Hernandez, Mirza Romero-Valdovinos, Pablo Maravilla (2013). Parasitic infections in a Mexican HIV/AIDS cohort. The Journal of Infection in Developing Countries PMID: 24129632 

Neumayr A, Hatz C, Blum J. In Press. Not be missed! Differential Diagnoses of Common Dermatological Problems in Returning Travellers. Travel Medicine and Infectious Disease. http://dx.doi.org/10.1016/j.tmaid.2013.09.005

Robertson LJ, Sprong H, Ortega YR, van der Giessen JW, Fayer R. In Press. Impact of globalisation on foodborne parasites. Trends in Parasitology  http://dx.doi.org/10.1016/j.pt.2013.09.005

Monday, April 29, 2013

'Invasive Blastocystis' in ECCMID 2013

ECCMID - the annual European Congress of Clinical Microbiology and Infectious Diseases (hosted by ESCMID) is currently taking place in Berlin. This year, I'm not attending, but I've been scanning the abstract book for 'Blastocystis', and it appears that an oral presentation was scheduled for yesterday in the "Emerging Infectious Diseases" section:

First of all: it's great to see fellow researchers screening larger (i.e. hundreds) of faecal DNAs by PCR for Blastocystis. I wish more people would do that to produce reliable data on prevalence and subtypes.

Now, as I've already mentioned, there are currently mainly two methods in use for subtyping, barcoding and STS PCR, and recently I evaluated these. To cut a long story short, barcoding is recommended for subtyping, since the STS method, which was used in the study by Tarasova et al. (abstract), appears to miss the majority of ST4 strains (the major genotype), and moreover, no STS primers exist for ST8 and ST9 (or any of the other 8 subtypes identified to date, but which have only been found in animals). So, the subtype data found in this study should be interpreted with this in mind.

Importantly however, I'm not sure whether the authors used the original Yoshikawa STS terminology or the terminology acknowledged in our 2007 consensus.

First, let us assume that consensus terminology is used. Then it's surprising to find ST5 in human samples in the first place, and finding a ST5 prevalence of 45% in a cohort of humans included in a larger study like this is very unlikely based on current evidence of more than 3,000 observations from all over the world, where the overall prevalence of ST5 in humans is <1%. Also, finding so much ST6 is also really striking. Also, if the consensus terminology is used, then I'm a bit puzzled why the authors put emphasis on ST7 not being found, since ST7 is relatively rare in humans.

And so let us assume that consensus terminology was not used, and the original Yoshikawa terminology was used instead. This would translate into STs 4, 6, and 7 not being detected in the CVH group. Which makes sense, since ST6 is extremely rare (at least in Europe), ST7 is only seen on occasion, and, as I said, the majority of ST4 infections are likely to go undetected by the STS method. However, ST4 appears quite common in Europe, and I suspect that it should be quite common in St Petersburg as well. But then there is one thing that comes to my mind: If ST4 infections are common, then there should be a relatively large number of samples detected by PCR which were untypable by PCR...and there is no information on untypable positive samples in the abstract...
But what is more:  STS subtype 5 translates into ST2 in consensus terminology, and similarly STS subtype 6 equals ST5 (yes, it may seem confusing, but we have provided a table in the 2007 consensus paper to make this easy). This means that no matter which of the two terminologies were used, ST5 is seen in abundance in patients with CVH in St Petersburg! Which is a very remarkable observation, and maybe more interesting than the rest of the data, which  I, by the way, find a bit difficult to follow (I expected to learn something about Blastocystis invasion, when I read the title of the abstract, but there is no data or information on invasiveness... and I'm very curious as to how the authors managed to obtain such a high number of samples from 'healthy people'! To evaluate the prevalence of Blastocystis in the control group, demographic data are needed, and a prevalence as low as 5.3% among healthy individuals makes me suspect that this control group consisted of newborns/toddlers who generally have a low prevalence of Blastocystis). Also, since when was ST1 'zoonotic'?

Anyway, often conference abstract are previews of upcoming articles, and so I expect that there will be a paper out soon from this group, and hopefully these issues will be clarified. The occasional confusion in Blastocystis epidemiology could be reduced to a minimum if everyone got into using barcoding and the Blastocystis 18S subtyping site (and go here for a video introduction to Blastocystis subtyping).

Are some citizens of St Petersburg infected by Blastocystis sp. ST5, a subtype seen primarily in livestock and African apes? Source

References:
Tarasova E, Suvorova M, Sigidaev A, Suvorov A. Blastocystis invasion in patients with chronic viral hepatitis in Saint Petersburg. ECCMID 2013 abstract O338.

Alfellani MA, Stensvold CR, Vidal-Lapiedra A, Onuoha ES, Fagbenro-Beyioku AF, & Clark CG (2013). Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Tropica, 126 (1), 11-8 PMID: 23290980

Stensvold CR (2013). Comparison of sequencing (barcode region) and sequence-tagged-site PCR for Blastocystis subtyping. Journal of Clinical Microbiology, 51 (1), 190-4 PMID: 23115257

Stensvold CR, Suresh GK, Tan KS, Thompson RC, Traub RJ, Viscogliosi E, Yoshikawa H, & Clark CG (2007). Terminology for Blastocystis subtypes--a consensus. Trends in Parasitology, 23 (3), 93-6 PMID: 17241816

Saturday, January 5, 2013

Where Are We On Blastocystis Subtypes?

As mentioned, Blastocystis exhibits remarkable intrageneric diversity, which is continuously being explored by us and our colleagues. We are convinced that the genus of Blastocystis comprises multiple species, but for now we call them "ribosomal lineages" or "subtypes" and allocate numbers to each subtype, hence ST1, ST2, etc. While the number of subtypes that can be found in humans remains stable, we and our colleagues are still expanding the subtype universe in non-human hosts (I will be blogging on this shortly).

Barcoding currently represents state-of-the-art in Blastocystis subtyping, and luckily this method appears to gain a foothold in labs across the world.

Nine subtypes have been found in humans, but some of them only on rare occasions. A recent study going out from London School of Hygiene and Tropical Medicine and led by Dr Alfellani and published just now in Acta Tropica looked at 356 Blastocystis sequences from samples from the UK and Libya, but also from sub-Saharan Africa, namely Liberia and Nigeria.


Wednesday, May 2, 2012

Blastocystis Sequence Typing Home Page

Last year, we launched the Blastocystis Sequence Typing Home Page, which is a publicly accessible resource including two major facilities: 1) A sequence database and 2) An isolate database.
The databases cover both SSU-rDNA data and Multilocus Sequence Typing (MLST) data. For those interested in MLST, please visit this paper.The rest of this post will be about SSU-rDNA sequences.

The database has a BLAST function. Barcoding sequences (i.e. sequences which include the 500 5'-most bases in the SSU-rDNA) can be submitted individually or in bulks, and the output file will include information on subtype (ST) and allele. The number of alleles in ST3 is huge (currently n=38) compared to other subtypes, for which only 2-3 alleles have been identified (e.g. ST8). In case a sequence is submitted that is not similar to an allele already present in the database, I suggest that you do an individual sequence query, which enables the generation of an alignment, which will show you the polymorphism(s). In case a new allele is identified, I suggest that we submit this new allele to the sequence database.
We not only strongly encourage using this BLAST feature for quick and standardised subtype and allele identification, but also for submitting isolate data, i.e. barcode sequences with provenance data (data on host, symptoms, geographical origin, etc.); again this can be done by contacting the curator (me); please look up the site for more information.

Our goal is to produce a database which accommodates large sets of data that can be submitted to scrutiny by everyone. The isolate database currently holds almost 700 isolates with 118 unique alleles - I hope this can be expanded much, much more. Also, data extracts can be done at all times, and below is a random example of an extract from human and non-human data from France downloaded from GenBank:
The colours indicate different alleles in different hosts (see legend to the right). A file with all alleles in fasta format is available here. You can paste them into the search field here for a total list of alleles currently in the database; try clicking on a couple to familiarise yourself with the system... One of the things that we can see here is that alleles 34, 36, 37 (ST3) and allele 4 (ST1) are the most common alleles in humans in France. It may seem a bit confusing to speak of both subtypes AND alleles. However, alleles are a good proxy for MLST data, and hence, looking at alleles is useful, e.g. in terms of transmission studies.

There are many other ways of extracting and visualising data from the isolate database. For more information on barcoding, subtypes, alleles, and the databases, please do not hesitate to contact me. I emphasise that the database only works with sequences that include the barcode region; mutliple SSU-rDNA targets have been used for subtyping, but due to the fact that this database is based on barcode data, we recommend that subtyping be done by barcoding (see references).

Useful literature:

Stensvold, C., Alfellani, M., & Clark, C. (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes Infection, Genetics and Evolution, 12 (2), 263-273 DOI: 10.1016/j.meegid.2011.11.002  

Scicluna SM, Tawari B, & Clark CG (2006). DNA barcoding of Blastocystis. Protist, 157 (1), 77-85 PMID: 16431158

Wednesday, April 18, 2012

Blastocystis Subtyping in Routine Microbiology Labs

When I speak to colleagues in and outside Europe and visit research portals and social media, including Facebook groups, I get the impression that Blastocystis subtyping is something that is still very rarely done, despite the fact that most clinical microbiologists and biologists acknowledge that subtypes may differ in terms of clinical significance and in other respects. We get new data on Blastocystis subtypes in various cohorts from time to time from research groups around the world, but all reports are characterised by relatively small sample sizes and subtyping methodology has not yet been standardised. This type of research is moreover challenged by the fact that Blastocystis is common in healthy individuals (i.e. people not seeing their GPs for gastrointestinal problems), and this makes it extremely difficult to identify the subtype distribution in the "background" population.

Although we recommend barcoding (see one of my previous posts) as the subtyping method of choice, there is no "official report" identifying the Blastocystis subtyping gold standard. Therefore, I'm currently setting up a lab project that is going to help us compare the most common methods used for subtyping in order to identify the one most suitable. I emphasise that the best method used for subtyping is not the PCR that should be used for diagnostic purposes, mostly due to the fact that PCRs for subtyping amplify 300-600 bp, which are much longer amplicons than the one we go for in diagnostic PCRs (typically 80-100 bp). We therefore recommend our novel TaqMan-based real-time PCR for initial diagnosis, or culture, which is inexpensive and relatively easy and provides you with a good source of cells for DNA extraction.
I hope that we will be able to come up with some robust data soon that will allow us to recommend the most suitable approach and hope to publish our results in a clinical microbiology journal of high impact, and I hope that this will prompt Blastocystis subtyping in many labs. Once this report has been published, I intend to upload a protocol here at the site where lab procedures for diagnosis and subtyping will be described in detail. Stay tuned!

Thursday, April 12, 2012

On Subtypes, Genotypes, Alleles and Sequence Types (SQTs)

There has been some confusion about Blastocystis "subtypes" and "genotypes". 

Often, these two terms have been used interchangeably. While “subtype” refers to a distinct ribosomal lineage (which in the case of Blastocystis may very well be a distinct species), “genotype” denotes variation WITHIN subtypes. 

Currently, there is no clear definition of genotypes in Blastocystis. Based on phylogenetic analysis of barcode sequences of ST4, the existence of two genotypes in ST4 has been mentioned (Stensvold et al., 2011).  

Based on markers in the mitochondrion-like organelle of Blastocystis, we recently developed MLST assays for ST3 and ST4 and published data on intra-subtype variation in these two subtypes (Stensvold et al., 2012). While 58 sequence types (SQTs) were found among 81 ST3 isolates, only 5 SQTs were found among 50 ST4 isolates. 

By comparing SQTs with barcode sequences, we discovered that barcode sequences belonging to the same subtype may display intra-subtype diversity, and we found out that barcode sequences can be seen as valid proxies for SQTs. We have chosen to use the term "allele" to enable denotation of variation in barcode sequences. Currently, we have discovered 38 ST3 alleles (i.e. 38 different ST3 barcode sequences) as opposed to 8 different ST4 alleles. There are still no published data on ST1 and ST2 SQTs, but given the fact that 22 different alleles have been discovered so far for each of these two subtypes, we may expect a substantial number of SQTs.

The world of Blastocystis terminology and subtyping, etc. may seem a bit overwhelming and at times confusing, but believe me, - much has improved since 2006, when Blastocystis terminology was completely up in the air! 

For more information or further clarification, please don't hesitate to contact me.

Cited literature:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol. 2012 Mar; 12 (2) :263-73. PubMed PMID:22116021.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. subtype 4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea. Am J Trop Med Hyg. 2011 Jun; 84 (6) :883-5. PubMed PMID:21633023; PubMed Central PMCID: PMC3110361.

Sunday, April 8, 2012

A Few Words On Blastocystis Morphology and Diagnosis

Blastocystis is a sinlge-celled parasite. The parasite produces cysts (probably the transmissible form) and vegetative stages (including the stage commonly referred to as the vacuolar stage). Vegetative stages are commonly seen in fresh faecal samples and in culture. This is what they look like under light microscopy:

Vegetative stages of Blastocystis (unstained) (source: www.dpd.cdc.gov)



Using permanent staining of fixed faecal material, the eccentrically located nuclei become more apparent:

Vegegtative stages of Blastocystis (Trichrome stain) (source: www.dpd.cdc.gov)


Although sensitive, permanent staining techniques (e.g. Trichrome, Giemsa and Iron Haematoxylin) are relatively time-consuming, impractical and expensive. Since also conventional concentration of unfixed stool using e.g. the Formol Ethyl-Acetate Concentration Technique is not appropriate for diagnosis (Blastocystis cysts are very difficult to pick up, and vacuolar stages become distorted or disintegrate), we recommend short-term in-vitro culture (using Jones' or Robinson's medium) and/or Real-Time-PCR on genomic DNAs extracted directly from faeces using QIAGEN Stool Mini Kit (QIAGEN, Hilden, Germany) or - in modern laboratories - by automated DNA extraction robots. Once genomic DNAs have been extracted and screened by PCR, positive samples can be submitted to subtyping using the barcoding method, and DNAs can be screened for other parasites by PCR as well. In fact the use of insensitive methods to distinguish carriers from non-carriers is one of our greatest obstacles to obtaining valid prevalence data on Blastocystis.

Having an isolate in culture adds the benefit of having a continuous source of DNA for further genetic characterisation (for instance complete SSU-rDNA sequencing) in case a particular isolate turns out to be genetically different from those already present in GenBank or the isolate database at Blastocystis Sequence Typing Home Page. And chances are that there are quite a few "novel" subtypes out there... especially in animals. However, Blastocystis from animals may not always be successfully established in culture.

Tuesday, April 3, 2012

Blastocystis Subtyping - Easy Peasy!

If you are a student or young scientist interested in intestinal parasites and/or infectious disease/molecular epidemiology, why not take to Blastocystis subtyping? It's easy, quick, cheap, and you are guaranteed results. You don't have to sit around and wait for positive samples.
And, best of all: Your data will make a difference!

Once you have your "barcode" sequence(s), you just paste them into the box as described below in the post "Is Blastocystis Zoonotic?", and you will get subtype and allele data right there, without having to consult other resources. However, we recommend that you familiarise yourself with essential papers such as 

Noel et al. (2005)
Scicluna et al. (2006)
Stensvold et al. (2007)

So, how do you get your sequences? Well, you can use DNAs extracted directly from faecal samples (faecal DNAs) or from cultures (I will soon post a note on Blastocystis culture). Multiple PCRs have been described for genetic characterisation of Blastocystis, and most of them target the small subunit (SSU) rRNA gene (18S).

For a variety of reasons (which we are currently listing in an upcoming review - watch out for it!), we recommend using the barcoding approach launched by Scicluna et al. (2006). The RD5 primer combined with BhRDr amplifies a region of approximately ~600 bp, which is usually sufficient to distinguish between subtypes.

Substantial sampling has been done in Europe, while data from Sub-Saharan Africa and the Americas are scarce. Sampling from animals is also highly warranted, especially from rodents, since this group appears to constitute a potential reservoir for human ST4.

In your search for subtypes, it is not unlikely that you will stumble upon what appears to be a new subtype, especially if you are analysing samples from animals. In that case, we recommened that you sequence the entire SSU rRNA gene. Using faecal DNA, this can be challenging (but possible!), so if you have the isolate in culture, then DNA should be extracted from the isolate and used instead to save money and effort. We are about to come up with some thoughts on how to determine whether a sequence represents a new subtype. Stay tuned!

Sunday, April 1, 2012

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:
AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA
Exactly! Subtype 1, allele 4!