Pages

▼

Lab Stuff

The Laboratory of Parasitology, Statens Serum Institut, Copenhagen, Denmark offers molecular detection and characterisation of various parasites relevant to the field of clinical microbiology.

We are especially experienced in DNA extraction from faecal samples and real-time PCR-based diagnosis of Entamoeba histolytica, Cryptosporidium, Giardia, Dientamoeba fragilis and Blastocystis. We also have real-time and conventional PCRs for many other protozoa and helminths, including soil-transmitted helminths such as Ascaris and Trichuris, and emerging tissue and blood parasites such as Babesia spp. We have recently developed an 18S PCR targeting non-human eukaryotic SSU rDNA in otherwise sterile patient material.
Finally, we also do a number of serological analyses, including extended serology for Toxoplasma gondii.
Diagnostic analyses (go here for updates):
  • Real-time PCR for Entamoeba histolytica, Entamoeba dispar, Cryptosporidium (parvum and hominis), Giardia, and Dientamoeba fragilis (070)
  • Real-time PCR for Entamoeba histolytica and Entamoeba dispar (075)
  • Real-time PCR for Cryptosporidium (parvum and hominis) and Giardia (077)
  • Real-time PCR for Dientamoeba fragilis (074)
  • Real-time PCR for Blastocystis ()
  • Subtyping of Blastocystis (barcoding) ()
  • Culture for Blastocystis (shipment of xenic cultures can be arranged) (097)
  • Conventional PCR for Cyclospora, Cystoisospora, and Cryptosporidium (genus) ()
  • Real-time PCR for microsporidia: Enterocytozoon bieneusi and Encephalitozoon spp. (707)
  • Real-time PCR for Trichuris (genus) (1004)
  • Real-time PCR for the differentiation of Trichuris trichiura from other Trichuris spp. ()
  • Real-time PCR for Ascaris (1005)
  • Conventional PCR for Taenia, including sequencing (species identification) (045) 
  • Microscopy of faecal concentrates (ova and cysts) (071)
  • Real-time PCR for Schistosoma spp. (1001)
  • Real-time PCR for Acanthamoeba (098)
  • Real-time PCR for Naegleria, Balamuthia and Acanthamoeba (099)
  • Real-time PCR for Babesia ()
  • Real-time PCR for Toxoplasma gondii (083)
  • Extended Toxoplasma gondii serology (congenital toxoplasmosis, acute toxoplasmosis) (380)
  • Real-time PCR-based species differentiation of Plasmodium (1002)
  • Real-time PCR-based detection of Leishmania + subsequent sequencing ()
  • Real-time PCR for the detection of Trypanosoma spp. ()
  • Conventional 18S PCR on DNA extracted from blood, CSF, tissue, aspirates, cysts, etc.

******************************************************************************** 

Culture of Blastocystis in Jones’ Medium.


For xenic (i.e. non-sterile) in-vitro cultivation of Blastocystis, Jones’ Medium is required:

Modified Jones’ Medium for in-vitro culture of Blastocystis

Stock solution
Na2HPO4              9.46 g in 1 L distilled water
KH2PO4                 9.08 g in 1 L distilled water
NaCl                     9.00 g in 1 L distilled water

To prepare Jones' Medium
1. Mix 93.8 mL Na2HPO4 with 31.3 mL KH2HPO4 and 562.5 mL NaCl.
2. To the buffered solution, add yeast extract (Oxoid) to 0.1%.
3. Autoclave at 15 lb inch-2 for 15 min.
4. Before use, add 10% horse serum (heat inactivated at 56ÂșC for 30 min) to Jones’ Medium.

For each faecal specimen transfer with a steril swab 50 mg faeces (or so) to a centrifuge tube with screw cap containing Jones’ Medium (3 ml will do). The culture is incubated at 37 °C for 48-72 h. (Note: The presence of bacteria in the sample will be enough for creating the anaerobic environment needed for Blastocystis to grow.) When subculturing, transfer about 50-100 uL of the sediment from each used culture into 3 ml fresh Jones’ medium containing 10% (heat inactivated) horse serum. Subculture every 3—4 days.

Examination
Cultures are examined with or without iodine at x 200 and x400 LM magnification and evaluated for the presence of especially vacuolar (the main stage seen) but also other stages of Blastocystis.

References
Zaman et al., 1994.  A comparison of direct microscopy with culture for the diagnosis of Blastocystis hominis.  Southeast Asian Journal of Tropical Medicine and Hygiene, 25: 792-793.
Leelayoova, S., et al. 2002. In-vitro cultivation: a sensitive method for detecting Blastocystis hominis. Annals of Tropical Medicine and Parasitology, 96: 803-807.
Personal communication Dr. Huw Smith, Glasgow (Suresh, K and Smith, H, 2004. Comparison of methods for detecting Blastocystis hominis. European Journal of Clinical Microbiology and Infectious Diseases 23: 509-511)

The original "Jones’ solution" (Jones, W. R. 1946):

Sterile horse serum                                        0,5 mL
1 % marmite solution**                                 1,0 mL
Buffer saline solution (pH 7,2)                        8,5 mL
Rice starch                                                     30 mg

** Marmite is autolysed yeast extract made by Marmite Limited, London

Reference:
Jones, W. R. 1946. The experimental infection of rats with Entamoeba histolytica; with a method for evaluating the anti-amoebic properties of new compounds. Annals of Tropical Medicine and Parasitology, 40: 130-140.

********************************************************************************

BARCODING (SUBTYPING)


Currently, the molecular epidemiology of Blastocystis can be studied at three levels: At subtype level, at 18S allele level and at sequence type level by multilocus sequence typing (MLST).
State-of-the-art subtyping relies on analysis of SSU rDNA sequencing of PCR products amplified by “pan-Blastocystis” primers, eg. by barcoding. Barcode primers (RD5/BhRDr) amplify the 0.6 5’-most kbp of the SSU rRNA gene and phylogenetic analysis has demonstrated that this region is a valid genetic marker of complete SSU rDNA sequences.

Barcode primers:

RD5: 5’-ATCTGGTTGATCCTGCCAGT-3’
BhRDr: 5'-GAGCTTTTTAACTGCAACAACG-3'

Usually, it's sufficient to sequence PCR products in only one direction, and the BhRDr primer usually works well as sequencing primer. 
Barcoding enables 18S allele analysis. A publicly available database is available at www.pubmlst.org/Blastocystis, which includes a sequence depository for barcode sequences and sequences obtained by multilocus sequence typing (MLST; see below) along with a BLAST facility where individual or bulks of fasta files can be uploaded for quick identification of subtype number, hence obviating the need for phylogenetic analysis. 18S allele analysis is a valid indicator of intra-subtype genetic variation, and to date more than 35 18S alleles for ST3 have been identified, whereas the number of 18S alleles for ST4 and some other subtypes remain much more limited; however, some of the allelic variation is due to cloning of strains and intra-cellular SSU rDNA polymorphism has been reported. 

You should try and BLAST the following example of fasta files on using this link: 

>gi|78057937|gb|DQ232840.1| Blastocystis hominis strain 00/389 
small subunit ribosomal RNA gene, partial sequence
AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATAGTTAACTTTGAAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGATGAAGAATACTAATTGGATAACCGTAGTAATTCTAGAGC
TAATACATGTATAAAGTCTTGTAGACTGCATTTATTAGAATGAAAACCATAGGTTTCGGCCTATTCGTGA
GTAATAATAACTAATCATATCGTATGCTTATGTAACGATGTGTCTTTCAAGTTTCTGCCCTATCAGCTTT
CGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGAGGG
AGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAGGGA
GGTAGTGACAATAAATCACAATGCGGAACAATGTTTTGCAATTGGATTGAGAACAACGTACAAACCTTAT
CGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCC

>gi|78057935|gb|DQ232838.1| Blastocystis hominis strain 00/400 
small subunit ribosomal RNA gene, partial sequence
AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTATAAATATTTAACTTTGAAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGATGAAAAGTACTACTTGGATAACCGTAGTAATTCTAGAGC
TAATACATGATAAAATCCTCGACTTTGAAGAGGTGTATTTATTAGAATGAAACCAATAGACTTCGGTCTG
TTTGTGAGTAATAATAACTAATCGTATCGCATGCTTAGGTAGCGATATGTCTTTCAAGTTTCTGCCCTAT
CAGCTTTGGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCG
GAGAGGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGAC
ATAGGGAGGTAGTGACAATAAATCACAATGCGGAACTATTAGTTTTGCAATTGGATTGAGAACAATGTAC
AAATGTTATCGATAAACAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCC 

 
Reference:
Sciluna, Tawari and Clark: DNA barcoding of Blastocystis.
Protist. 2006 Feb;157(1):77-85. Epub  2006 Jan 23. 
 

No comments:

Post a Comment