Pages

▼

Thursday, April 26, 2012

1,000 page views!

This blog was put up not even a month ago, and I'm happy to see that the blog has had more than 1,000 page views already! Main interest seems to come from the USA, Australia, Canada and the UK.
I celebrate the "anniversary" by enabling Google Translate - so now this blog should be available in multiple languages. Thanks for stopping by!

What is Blastocystis?

Intestinal parasites of humans can be divided into mainly helminths ('worms' including cestodes, nematodes and trematodes), and single-celled eukaryotic organisms. Most single-celled intestinal parasites belong to one of four main groups:
  • Archamoebae or Amoeboids (e.g. Entamoba, Iodamoeba, Endolimax)
  • Ciliates (e.g. Balantidium)
  • Sporozoa (e.g. Cryptosporidium, Cyclospora, Cystoisospora; even microsporidia)
  • Flagellates (e.g. Giardia, Chilomastix, Enteromonas, Pentatrichomonas, Retortamonas, Dientamoeba (unflagellated flagellate!))
Traditionally, these four groups have been referred to as protozoa.

However, the most common, single-celled intestinal parasitic eukaryote, Blastocystis, does not belong in any of these four categories. Taxonomically, Blastocystis belongs to the heterogeneous group of Stramenopiles, which includes slime nets, diatoms, water moulds and brown algae. Most stramenopiles are free-living organisms. Blastocystis is an atypical stramenopile not only as this group is named for the straw-like tubular hairs on the flagella and sometimes the cell body - Blastocystis has no flagella and lacks any tubular hairs - but also due to its parasitic nature.

Often, Blastocystis is referred to as a 'protozoon', although 'protist' is more appropriate. Protists can be defined basically as any eukaryote that is not a plant, an animal or a fungus.

One of the closest relatives of Blastocystis identified to date is Proteromonas lacertae, a parasite of reptiles.

Interestingly, Proteromonas does have flagella and hairs on the cell body. For comparison, the image below shows Blastocystis (culture) - appearing almost amoeboid, only with very limited morphological hallmarks (note examples of binary fission and the eccentrically located nuclei and mitochondrion-like organelles).

Blastocystis is one of two Stramenopiles known to infect humans, the other being Pythium insidiosum, which has been associated with keratitis and dermatological lesions mainly in SE Asia.

Other organisms with close relation to Blastocystis include Karotomorpha, Cepedea, Protoopalina and Opalina.

For further information, please visit

Silberman, J., Sogin, M., Leipe, D., & Clark, C. (1996). Human parasite finds taxonomic home Nature, 380 (6573), 398-398 DOI: 10.1038/380398a0  

HOEVERS, J., & SNOWDEN, K. (2005). Analysis of the ITS region and partial ssu and lsu rRNA genes of Blastocystis and Proteromonas lacertae Parasitology, 131 (2), 187-196 DOI: 10.1017/S0031182005007596  

Kostka, M., Cepicka, I., Hampl, V., & Flegr, J. (2007). Phylogenetic position of Karotomorpha and paraphyly of Proteromonadidae Molecular Phylogenetics and Evolution, 43 (3), 1167-1170 DOI: 10.1016/j.ympev.2006.11.002

Wednesday, April 25, 2012

Blastocystis Facts Sheet

I've tried to summarise a few facts here:
  • Blastocystis is a single-celled, microbial parasitic protist colonising mainly the large intestine of man and other mammals, birds, reptiles, and other animals, even insects.
  • The parasite is extremely common in humans, and possibly the most common microbial non-fungal eukaryote in the human intestine. More than one billion people may be colonised.
  • Blastocystis comprises many ribosomal lineages, most or all of which are comparable to separate species; they are currently known as subtypes (ST).
  • Humans are common hosts of ST1, ST2, ST3 and ST4, whereas other subtypes such as ST6, ST7 and ST8 are seen occasionally. ST5 and ST9 are very rare in humans. 
  • Almost all subtypes found in humans are also found in animals; however, zoonotic transmission is probably uncommon, at least for the most common subtypes (ST1—ST4).
  • Most carriers do probably not experience more intestinal symptoms than the average individual.
  • We do not know when to seek to eradicate Blastocystis and there are no valid treatment guidelines. The effect of metronidazole may be very limited.
  •  ST3 is probably the most common subtype in humans.
  • ST4 may be more much more common in Europe than outside Europe. 
  • ST4 has been seen frequently in patients with different types of diarrhoea or other intestinal problems, but appears uncommon in healthy individuals.
  • Blastocystis is best detected by (real-time) PCR and culture; conventional parasitological techniques have generally poor sensitivity.
·         Ongoing epidemiological studies seek to analyse subtype distributions in various cohorts, e.g. IBS patients and the background population. We also continuously explore the genetic variation and host specificity of Blastocystis. Genome studies seek to unravel virulence genes that may be involved in pathogenesis, but only the genome for ST7 has been sequenced so far.

Monday, April 23, 2012

Intestinal Symptoms

For over a century, the clinical significance of Blastocystis has puzzled medical doctors scientists. After realising the extensive genetic diversity in Blastocystis, one of the current main hypotheses is that Blastocystis subtypes differ in terms of clinical significance. In other words: Symptoms, such as diarrhoea or other intestinal upset, may be associated only with one or more subtypes, while other subtypes are strict commensals.

Blastocystis is very difficult to eradicate and colonisation is chronic. Do symptoms caused by potentially  pathogenic subtypes persist or do they develop initially only to diminish after host immunological adaptation? Do fluctuations in symptoms reflect fluctuations in parasite load? Such issues ire important when interpreting results generated from cross-sectional surveys of subtypes in various cohorts.
Moreover, intestinal symptoms are difficult to define. Diarrhoea may be defined by 3 stool passages per day or more, while many other symptoms can be very difficult to define, if at all possible. Irritable bowel syndrome (IBS) and - to some extent - food allergy may both be considered differential diagnoses of symptomatic Blastocystis infections.

IBS diagnosis is currently defined by the Rome III criteria, and there are at least three types of IBS, namely IBS with diarrhoea, IBS with constipation and IBS with a mixture of diarrhoea and constipation.

Symptoms may be experienced differently from person to person. While abdominal cramping is perceived mostly as a symptom and something unpleasant, flatulence may by many be seen as a sign of a "healthy tummy" (e.g. due to consumption of a high fibre diet), although "inconvenient". Some individuals may very well tolerate intermittent intestinal symptoms and do not consult their GPs or other health care professionals, while others may be much more sensitive to any changes in for instance stool patterns.

What some people do not realise is that many methods fail to detect Blastocystis. PCR and culture are the most sensitive methods, but are still only rarely used. Moreover, PCR is also suitable for the detection of Dientamoeba fragilis, which is a parasite often seen in co-infection with Blastocystis. These two parasites are probably the most common single-celled eukaryotes in the human intestine.

This means that complete and accurate microbiological make-ups are far from always performed. And so, incomplete microbiological examination coupled with differential diagnostic challenges, potential immunological adaptation and the very subjective components of symptom presentation renders our quest for clear-cut associations extremely challenging. Blastocystis will often be seen as the culprit of symptoms, possibly simply to the reason that it is the only potential microbial pathogen that has been demonstrated in a stool sample. Cohort studies using sensitive diagnostic methods for pathogen surveillance are expensive, but may be one of the few only ways forward with regard to epidemiological studies that can assist us in resolving the clinical significance of Blastocystis.

Wednesday, April 18, 2012

Blastocystis Subtyping in Routine Microbiology Labs

When I speak to colleagues in and outside Europe and visit research portals and social media, including Facebook groups, I get the impression that Blastocystis subtyping is something that is still very rarely done, despite the fact that most clinical microbiologists and biologists acknowledge that subtypes may differ in terms of clinical significance and in other respects. We get new data on Blastocystis subtypes in various cohorts from time to time from research groups around the world, but all reports are characterised by relatively small sample sizes and subtyping methodology has not yet been standardised. This type of research is moreover challenged by the fact that Blastocystis is common in healthy individuals (i.e. people not seeing their GPs for gastrointestinal problems), and this makes it extremely difficult to identify the subtype distribution in the "background" population.

Although we recommend barcoding (see one of my previous posts) as the subtyping method of choice, there is no "official report" identifying the Blastocystis subtyping gold standard. Therefore, I'm currently setting up a lab project that is going to help us compare the most common methods used for subtyping in order to identify the one most suitable. I emphasise that the best method used for subtyping is not the PCR that should be used for diagnostic purposes, mostly due to the fact that PCRs for subtyping amplify 300-600 bp, which are much longer amplicons than the one we go for in diagnostic PCRs (typically 80-100 bp). We therefore recommend our novel TaqMan-based real-time PCR for initial diagnosis, or culture, which is inexpensive and relatively easy and provides you with a good source of cells for DNA extraction.
I hope that we will be able to come up with some robust data soon that will allow us to recommend the most suitable approach and hope to publish our results in a clinical microbiology journal of high impact, and I hope that this will prompt Blastocystis subtyping in many labs. Once this report has been published, I intend to upload a protocol here at the site where lab procedures for diagnosis and subtyping will be described in detail. Stay tuned!

Friday, April 13, 2012

Blastocystis @ EzineArticles

I realise that output from my research ends up being read/noticed by only relatively few people compared to the number of individuals colonised by Blastocystis (!) This is due to the fact that research results are published in a language and context not always easily understood by laymen, and that few of my articles are available online free of charge.

This is part of why I created this blog. And  now I also have the pleasure of recommending a Blastocytis article on EzineArticles: Blastocystis - Everyone's Parasite?

Please share.

Thursday, April 12, 2012

On Subtypes, Genotypes, Alleles and Sequence Types (SQTs)

There has been some confusion about Blastocystis "subtypes" and "genotypes". 

Often, these two terms have been used interchangeably. While “subtype” refers to a distinct ribosomal lineage (which in the case of Blastocystis may very well be a distinct species), “genotype” denotes variation WITHIN subtypes. 

Currently, there is no clear definition of genotypes in Blastocystis. Based on phylogenetic analysis of barcode sequences of ST4, the existence of two genotypes in ST4 has been mentioned (Stensvold et al., 2011).  

Based on markers in the mitochondrion-like organelle of Blastocystis, we recently developed MLST assays for ST3 and ST4 and published data on intra-subtype variation in these two subtypes (Stensvold et al., 2012). While 58 sequence types (SQTs) were found among 81 ST3 isolates, only 5 SQTs were found among 50 ST4 isolates. 

By comparing SQTs with barcode sequences, we discovered that barcode sequences belonging to the same subtype may display intra-subtype diversity, and we found out that barcode sequences can be seen as valid proxies for SQTs. We have chosen to use the term "allele" to enable denotation of variation in barcode sequences. Currently, we have discovered 38 ST3 alleles (i.e. 38 different ST3 barcode sequences) as opposed to 8 different ST4 alleles. There are still no published data on ST1 and ST2 SQTs, but given the fact that 22 different alleles have been discovered so far for each of these two subtypes, we may expect a substantial number of SQTs.

The world of Blastocystis terminology and subtyping, etc. may seem a bit overwhelming and at times confusing, but believe me, - much has improved since 2006, when Blastocystis terminology was completely up in the air! 

For more information or further clarification, please don't hesitate to contact me.

Cited literature:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect Genet Evol. 2012 Mar; 12 (2) :263-73. PubMed PMID:22116021.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. subtype 4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea. Am J Trop Med Hyg. 2011 Jun; 84 (6) :883-5. PubMed PMID:21633023; PubMed Central PMCID: PMC3110361.

Sunday, April 8, 2012

A Few Words On Blastocystis Morphology and Diagnosis

Blastocystis is a sinlge-celled parasite. The parasite produces cysts (probably the transmissible form) and vegetative stages (including the stage commonly referred to as the vacuolar stage). Vegetative stages are commonly seen in fresh faecal samples and in culture. This is what they look like under light microscopy:

Vegetative stages of Blastocystis (unstained) (source: www.dpd.cdc.gov)



Using permanent staining of fixed faecal material, the eccentrically located nuclei become more apparent:

Vegegtative stages of Blastocystis (Trichrome stain) (source: www.dpd.cdc.gov)


Although sensitive, permanent staining techniques (e.g. Trichrome, Giemsa and Iron Haematoxylin) are relatively time-consuming, impractical and expensive. Since also conventional concentration of unfixed stool using e.g. the Formol Ethyl-Acetate Concentration Technique is not appropriate for diagnosis (Blastocystis cysts are very difficult to pick up, and vacuolar stages become distorted or disintegrate), we recommend short-term in-vitro culture (using Jones' or Robinson's medium) and/or Real-Time-PCR on genomic DNAs extracted directly from faeces using QIAGEN Stool Mini Kit (QIAGEN, Hilden, Germany) or - in modern laboratories - by automated DNA extraction robots. Once genomic DNAs have been extracted and screened by PCR, positive samples can be submitted to subtyping using the barcoding method, and DNAs can be screened for other parasites by PCR as well. In fact the use of insensitive methods to distinguish carriers from non-carriers is one of our greatest obstacles to obtaining valid prevalence data on Blastocystis.

Having an isolate in culture adds the benefit of having a continuous source of DNA for further genetic characterisation (for instance complete SSU-rDNA sequencing) in case a particular isolate turns out to be genetically different from those already present in GenBank or the isolate database at Blastocystis Sequence Typing Home Page. And chances are that there are quite a few "novel" subtypes out there... especially in animals. However, Blastocystis from animals may not always be successfully established in culture.

Friday, April 6, 2012

Why "Blastocystis sp." and not "Blastocystis hominis"?

Blastocystis identified in humans used to be referred to as "Blastocystis hominis". However, after the advanced use of nucleic acid-based tools in the 90s and 00s it became clear that

1) morphologically identical Blastocystis can be genetically extremely diverse
2) Blastocystis in humans comprises at least 9 species (or, perhaps more correctly, ribosomal lineages), 8 of which can be found in other animals as well.

This means that host origin is not a reliable indicator of organism identity.

Blastocystis appears to exhibit only moderate host specificity - at least at subtype level - , and until a more substantial sampling from various hosts has been carried out, we will have to go with "Blastocystis sp." followed by an appropriate subtype (ST) number (according to species/ribosomal lineage), e.g. "Blastocystis sp. ST3", which is one of the 4 subtypes commonly found in humans.

In order to make subtype analysis very easy, we have created a site (together with Keith Jolley, Oxford University), where a bulk of sequences can be assigned to subtype in few seconds. Single sequence entries are also possible.

To sum up: Blastocystis hominis is a misleading and currently an invalid taxon.

(Read more about this in our Blastocystis consensus paper from 2007 in Trends in Parasitology)

Thursday, April 5, 2012

Happy Easter!

I’m still exploring the potential of this blog. I’m happy to see that I have a constant flow of visitors. The aim of the blog is to serve primarily as a resource for ”people in business” and for all of those who are colonised with Blastocystis or who take an interest in the parasite for some reason.

As a courtesy to my colleagues, I plan to provide regular updates on Blastocystis research, information on tools that will make your Blastocystis studies easier, SOPs and protocols on lab procedures such as sampling, culture, PCR screening, subtyping, sequence typing (MLST), phylogenetic analysis and identification of (new) subtypes. Occasionally, I will also try to go into more detail with some of the things that I find particularly interesting.

For those not in business but who seek some useful information on Blastocystis I plan to do a short overview with some bullet points in plain language on the clinical and public health significance of Blastocystis, - what to think of it, when to treat, transmission, prevalence, etc. For all, it is important for me to try and provide some impartial information on Blastocystis; there are people out there trying to make a commercial success of Blastocystis, perpetuating anecdotal data and information on the parasite for which there is currently no support. 

Tuesday, April 3, 2012

Blastocystis Subtyping - Easy Peasy!

If you are a student or young scientist interested in intestinal parasites and/or infectious disease/molecular epidemiology, why not take to Blastocystis subtyping? It's easy, quick, cheap, and you are guaranteed results. You don't have to sit around and wait for positive samples.
And, best of all: Your data will make a difference!

Once you have your "barcode" sequence(s), you just paste them into the box as described below in the post "Is Blastocystis Zoonotic?", and you will get subtype and allele data right there, without having to consult other resources. However, we recommend that you familiarise yourself with essential papers such as 

Noel et al. (2005)
Scicluna et al. (2006)
Stensvold et al. (2007)

So, how do you get your sequences? Well, you can use DNAs extracted directly from faecal samples (faecal DNAs) or from cultures (I will soon post a note on Blastocystis culture). Multiple PCRs have been described for genetic characterisation of Blastocystis, and most of them target the small subunit (SSU) rRNA gene (18S).

For a variety of reasons (which we are currently listing in an upcoming review - watch out for it!), we recommend using the barcoding approach launched by Scicluna et al. (2006). The RD5 primer combined with BhRDr amplifies a region of approximately ~600 bp, which is usually sufficient to distinguish between subtypes.

Substantial sampling has been done in Europe, while data from Sub-Saharan Africa and the Americas are scarce. Sampling from animals is also highly warranted, especially from rodents, since this group appears to constitute a potential reservoir for human ST4.

In your search for subtypes, it is not unlikely that you will stumble upon what appears to be a new subtype, especially if you are analysing samples from animals. In that case, we recommened that you sequence the entire SSU rRNA gene. Using faecal DNA, this can be challenging (but possible!), so if you have the isolate in culture, then DNA should be extracted from the isolate and used instead to save money and effort. We are about to come up with some thoughts on how to determine whether a sequence represents a new subtype. Stay tuned!

Sunday, April 1, 2012

Scientific Output From My Blastocystis Research

My Blastocystis-related publications can be viewed here:
sciseekclaimtoken-4f7b17c9121c3

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:
AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA
Exactly! Subtype 1, allele 4!