Blastocystis: To Treat or Not to Treat...

This year, Coyle et al. published a Clinical Practice paper in Clinical Infectious Diseases, a journal with a 5-year impact factor of almost 8. It is still difficult to get papers on Blastocystis published in clinical, peer-reviewed journals of major impact, probably due to the fact that evidence of Blastocystis' pathogenicity is so far only indicative, so it is great to see that the authors have managed to get their manuscript past those iron doors!

A few issues have come to my attention. When reading the abstract the reader will get the impression that subtypes are synonymous with genotypes, which is not the case. In the case of Blastocystis, a subtype is equivalent to a species; one of the reasons why we haven't allocated species names to Blastocystis from humans, other mammals and birds yet, is that we do not have sufficient data on genetic diversity and host specificity to come up with relevant names.

It says in the first page (pdf) that Blastocystis subtype (ST) 3 is found only in humans, which is not true. This subtype is common in non-human primates and can be seen in other, larger animals, including dogs, and also birds, if I remember correctly. However, so far, we only have multilocus sequence typing data from human and non-human primates, and these data indicate that ST3 found in non-human primates is often different from ST3 found in humans.

The authors recommend that asymptomatic individuals with few cysts should not be treated. Then what about asymptomatic individuals with many cysts? Also, with the diagnostic short-comings of microscopy of faecal concentrates, the suggested cut-off at 5 organisms per visual field appears arbitrary and, in best case, fortuitous.

In the abstract, the authors state that metronidazole is the drug of choice, although they appear to be quite aware that this drug has limited effect in terms of eradicating Blastocystis. So, why is metronidazole the drug of choice? Blastocystis is a parasite lodged primarily in the large intestine, and therefore we must anticipate that metronidazole often fails to reach the the parasite in sufficient concentrations due to absorption proximally in the gut. Luminal agents, such as paromomycin, are probably more likely to work, maybe in combination with metronidazole, although we have had a case, where even this combination was not effective.

When reviewing studies of treatment, it is important to acknowledge that insensitive methods have been used to evaluate drug efficacy. Culture combined with PCR is in my opinion the best method available in this respect. I prefer adding culture to the test, since culture detects viable Blastocystis (as opposed to PCR which will detect both viable and non-viable cells). Future randomised controlled treatment studies should therefore use culture and PCR to identify carriers both pre- and post-treatment. Whether Blastocystis-positive stool post-treatment is due to recrudescence, resistance or reinfection is not easily evaluated, but some useful information can be achieved by multi-locus sequence typing of isolates pre- and post-treatment.

Literature cited:

Coyle CM, Varughese J, Weiss LM, & Tanowitz HB (2012). Blastocystis: to treat or not to treat... Clinical infectious diseases : an official publication of the Infectious Diseases Society of America, 54 (1), 105-10 PMID: 22075794  

Stensvold CR, Alfellani M, & Clark CG (2012). Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 12 (2), 263-73 PMID: 22116021  

Stensvold CR, Smith HV, Nagel R, Olsen KE, & Traub RJ (2010). Eradication of Blastocystis carriage with antimicrobials: reality or delusion? Journal of clinical gastroenterology, 44 (2), 85-90 PMID: 19834337

Blastocystis Facts Sheet

I've tried to summarise a few facts here:

• Blastocystis is a single-celled, microbial parasitic protist colonising mainly the large intestine of man and other mammals, birds, reptiles, and other animals, even insects.
• The parasite is extremely common in humans, and possibly the most common microbial non-fungal eukaryote in the human intestine. More than one billion people may be colonised.
• Blastocystis comprises many ribosomal lineages, most or all of which are comparable to separate species; they are currently known as subtypes (ST).
• Humans are common hosts of ST1, ST2, ST3 and ST4, whereas other subtypes such as ST6, ST7 and ST8 are seen occasionally. ST5 and ST9 are very rare in humans. 
• Almost all subtypes found in humans are also found in animals; however, zoonotic transmission is probably uncommon, at least for the most common subtypes (ST1—ST4).
• Most carriers do probably not experience more intestinal symptoms than the average individual.
• We do not know when to seek to eradicate Blastocystis and there are no valid treatment guidelines. The effect of metronidazole may be very limited.
•  ST3 is probably the most common subtype in humans.
• ST4 may be more much more common in Europe than outside Europe. 
• ST4 has been seen frequently in patients with different types of diarrhoea or other intestinal problems, but appears uncommon in healthy individuals.
• Blastocystis is best detected by (real-time) PCR and culture; conventional parasitological techniques have generally poor sensitivity.

·         Ongoing epidemiological studies seek to analyse subtype distributions in various cohorts, e.g. IBS patients and the background population. We also continuously explore the genetic variation and host specificity of Blastocystis. Genome studies seek to unravel virulence genes that may be involved in pathogenesis, but only the genome for ST7 has been sequenced so far.

Why "Blastocystis sp." and not "Blastocystis hominis"?

Blastocystis identified in humans used to be referred to as "Blastocystis hominis". However, after the advanced use of nucleic acid-based tools in the 90s and 00s it became clear that

1) morphologically identical Blastocystis can be genetically extremely diverse
2) Blastocystis in humans comprises at least 9 species (or, perhaps more correctly, ribosomal lineages), 8 of which can be found in other animals as well.

This means that host origin is not a reliable indicator of organism identity.

Blastocystis appears to exhibit only moderate host specificity - at least at subtype level - , and until a more substantial sampling from various hosts has been carried out, we will have to go with "Blastocystis sp." followed by an appropriate subtype (ST) number (according to species/ribosomal lineage), e.g. "Blastocystis sp. ST3", which is one of the 4 subtypes commonly found in humans.

In order to make subtype analysis very easy, we have created a site (together with Keith Jolley, Oxford University), where a bulk of sequences can be assigned to subtype in few seconds. Single sequence entries are also possible.

To sum up: Blastocystis hominis is a misleading and currently an invalid taxon.

(Read more about this in our Blastocystis consensus paper from 2007 in Trends in Parasitology)

Blastocystis Subtyping - Easy Peasy!

If you are a student or young scientist interested in intestinal parasites and/or infectious disease/molecular epidemiology, why not take to Blastocystis subtyping? It's easy, quick, cheap, and you are guaranteed results. You don't have to sit around and wait for positive samples.
And, best of all: Your data will make a difference!

Once you have your "barcode" sequence(s), you just paste them into the box as described below in the post "Is Blastocystis Zoonotic?", and you will get subtype and allele data right there, without having to consult other resources. However, we recommend that you familiarise yourself with essential papers such as 

Noel et al. (2005)
Scicluna et al. (2006)
Stensvold et al. (2007)

So, how do you get your sequences? Well, you can use DNAs extracted directly from faecal samples (faecal DNAs) or from cultures (I will soon post a note on Blastocystis culture). Multiple PCRs have been described for genetic characterisation of Blastocystis, and most of them target the small subunit (SSU) rRNA gene (18S).

For a variety of reasons (which we are currently listing in an upcoming review - watch out for it!), we recommend using the barcoding approach launched by Scicluna et al. (2006). The RD5 primer combined with BhRDr amplifies a region of approximately ~600 bp, which is usually sufficient to distinguish between subtypes.

Substantial sampling has been done in Europe, while data from Sub-Saharan Africa and the Americas are scarce. Sampling from animals is also highly warranted, especially from rodents, since this group appears to constitute a potential reservoir for human ST4.

In your search for subtypes, it is not unlikely that you will stumble upon what appears to be a new subtype, especially if you are analysing samples from animals. In that case, we recommened that you sequence the entire SSU rRNA gene. Using faecal DNA, this can be challenging (but possible!), so if you have the isolate in culture, then DNA should be extracted from the isolate and used instead to save money and effort. We are about to come up with some thoughts on how to determine whether a sequence represents a new subtype. Stay tuned!

Is Blastocystis Zoonotic?

All 9 subtypes (species) of Blastocystis found in humans so far have been found in other animals, and Blastocystis is proabably at least as prevalent in most animal groups as in humans.

ST1, ST2, ST3 and ST4 are the most common subtypes in humans, but sometimes ST7 or ST8, and, even more rarely, ST5, ST6 and ST9 are found. Our experience tells us that the main reservoir of ST6 and ST7 may be birds, and so the finding of these two subtypes in humans may be a result of zoonotic transmission. ST8 is common in some groups of non-human primates (NHPs) (look out for our upcoming paper on NHP Blastocystis!), and maybe ST8 in humans is a result of close contact to NHPs.

Recent multilocus sequence typing (MLST) analysis of ST3 isolates from humans and non-human primates indicates that ST3 from non-human primates is essentially different from ST3 in humans. We know that ST3 is found in other mammals, e.g. bovids and suids, and we hope that soon we or others will take to analysing ST3 from animals by MLST in order to establish whether non-primate ST3 differs from primate ST3.

So far, ST4 has been detected in mainly humans, a few NHPs, rodents and marsupials. There are two genotypes of ST4, one of which appears to be very rare. The other genotype is common, at least in Europe, and by MLST analysis we have found no genetic difference between ST4 from a guinea pig and human ST4.To read more about our MLST results, go here.

Efforts to establish facts on zoonotic transmission in Blastocystis are certainly premature. We need more sampling from various animal groups to further investigate to which extent human Blastocystis is mainly a result of anthroponotic or zoonotic transmission.To this end, we recommend screening faecal DNAs by PCR and do subtyping using the "barcoding" method published by Sciluna et al. (2006). Sequences obtained by barcoding can easily be identified to the subtype and allele level here. You can try it by copying the following nucleotide sequence (Small subunit rDNA) and pasting it into the search box and subsequently pressing the "submit" button:

AGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTGTAAGTGTAAATATCAAAGTTTGGAACTGCGAA
TGGCTCATTATATCAGTTATAGTTTATTTGGTGAAGTGTACTACTTGGATAACCGTAGTAATTCTAGGGC
TAATACATGAGAAAGTCCTCTGGTGAGGTGTGTTTATTAGAATGAAAACCATATGCTTCGGCATGATAGT
GAGTAATAGTAACCTATCGTATCGCATGCTTAATGTAGCGATGAGTCTTTCAAGTTTCTGCCCTATCAGC
TTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGA
GGGAGCCTGAGAGATGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATCCTGACACAG
GGAGGTAGTGACAATAAATCACAATGCGGGACTATACGTCTTGCAATTGGATTGAGAACAATGTACAGCT
CTTATCGATA

Exactly! Subtype 1, allele 4!

Some updates on Blastocystis

Blastocystis is a micro-eukaryote, a so-called protist, parasitising the intestine of humans and a variety of animals.

We estimate that at least 1 billion people worldwide are colonised by this parasite, and we believe that the majority experience no more episodes of intestinal upset, e.g. diarrhoea, than the average individual.

Blastocystis colonises the intestine for a long time (probably months or years).

Many species of Blastocystis are known, of which at least 9 have been found in humans. Such species are currently termed "subtypes" (STs). ST1, ST2, ST3 and ST4 are common in Europe. While ST1, ST2, and ST3 appear to have equal prevalences in patients with diarrhoea and healthy individuals, ST4 appears to be linked to diarrhoea and/or chronic conditions such as irritable bowel syndrome (IBS).

There is no known efficient treatment of Blastocystis. Although metronidazole is often prescribed for Blastocystis infections, there is conflicting reports on its efficacy. Even in combination with a luminal agent, such as paromomycin, Blastocystis eradication cannot be guaranteed.

Whether Blastocystis causes symptoms in humans may depend on factors such as co-evolution. ST3 is the most common subtype in humans and ST3 may account for 30-50% of Blastocystis in humans. ST3 shows substantial intra-subtype genetic variation, and we believe that Blastocystis ST3 has co-evolved with humans, and therefore we may have adapted to ST3 colonisation. ST4 on the other hand is almost clonal and may have entered the human population relatively recently. This could partly explain why ST4 colonisation has been linked to intestinal symptoms.

Further reading:
1. Stensvold CR, Alfellani M, Clark CG. Levels of genetic diversity vary dramatically between Blastocystis subtypes.
2. Stensvold CR, Christiansen DB, Olsen KE, Nielsen HV. Blastocystis sp. ST4 is common in Danish Blastocystis-positive patients presenting with acute diarrhea.